Summary
Transcript IDgene_000006673
Gene IDTTHERM_00549620
Length1685 bp
Sequence
TTATTTATTTGTTTATTTATTTATTTTTCAGTGATAAACAGTAAAGAGCAAAAGAATTTCTATTGAGCCAATTTATAAAGGAATCATTTCTATTTTTACAGGATAGCTTTATGAGTAAAAACTCTTATTATACCACTTAGCAAGGGTAGGCTTAGTCAAAATCTGCTAACTATCTTGATTTAATCAAGGGTGGTGTTTCAGTCAGAAGTCCAAATAAACTGAACTTTAATGAACATGGGAATACAAAGAAGTATTTAAATGAAAAAGAAAACTATTGTAAGGAGTCAAGAATTAAAGATGCTGGGAAATAGAGTATTCTATCAACTATTAGTATGAGCAATCAAAAAGAATAATCAGAAAAAAATCGCCTTAGCAACGAATCATAAAACCTGAATGATCTTGATATAAAACACCTTACAAATACAAGACAAAAAGTTTAAAATAGGAAGAATGTAATGGAATTAAAAAATCAGATGAGTCCTGTTTACTTCAATAGAGATGCGGAAAGATTTAGCTACTTAGATTATTAAGATCCGTTAACAGGCAACTAGATTTATTAATACAATAAAAATAATGTTTTACAATAGTATCAATATAATAACCATTATCCACAATAAATGATAAATTAGGAATAATATGCTTATGCTAATAAGTATCATCATCATTCATAATCTCCTACACCTCATCTTTATAATAATAATAATTACAACAATTTTAATGCTTATACAAGAAAGGATATTTCAGCAATCAACGAATATATAAAATAAAACTAACACTTTAAATCTGAAAATTCTAGCTTAAGCTCTATTTTACCAGACAATAAATGCTCTTTTTTGTCTGATTAATCAGAATATATTACAGAAAGGAGAGAAGATTCCTTTGGTAATGTAGAGATTGTAAGGAGAAAAATTGAATAACCTCAAAATAAAGGAGTTAATAATCTACAAGCTCCTAATCTTCCTCAGCCTCCTAGCGTATCTGATCCTGATCTATAGAAGTACACTCGTAATAACTTAAATTAACCAATCAGTACTGCTTATTAAGTTAATGATAATAGATCATAAGCTAGACTAATTCCAAAAATTAACTTTGCTACAATTATATTTTTGATTCTTCTTATATACGTTGCCTATAAAAATATCAATAAATTCTTAAATGGTGAAAGTATTTTTAATTAATTGACAGCTTCTTTTAAAAATTTTGGGTTAGAATACAATAAGAAGCCTTCTTAAACTAAAAATAAAATAAATAATGAAAATCTGTACTAGTAAAACTCTTTCGATAGCAATAACGATAGTAACATGGATAACTCAAAAACTAATATATATATAAAAGAAGAAATTAAATAAGATATGGATTCCAATTTAGCGAAAAAGTTTGCTAAAGAATTGGTAATAGAATTAGCAGATTTATTAAAAGTAAAAGGAAAATTGTATCGATCTGAGTATGAAGAAAATCTAAGCAAGAGATTTATGAACACTATGCTAAGAGAAATTCTACCAGAAATAAATAAATTACTATTAAATTCAAAGCATATTAGAATTTAATATGATGTTATTAACAGACAAGATTATTTTGAGCTATTTCCTTAAAATTTCAATAATTAATGAATTTGATTACGTGAGAAAAAAATAAAAATGTGTATTTATTAATGTATAGCAATAAAATAAAATCTAAAAAATAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1464.2 L-2516.7 L-3357.4 S-0300.6 S-3422.5
S-6287.9 S-9442.9 S-12463.9 S-15510.2 S-24381.5
C-067.5 C-211,843.9 C-45,662.0 C-64,524.4 C-83,253.3
C-101,207.0 C-121,907.0 C-141,064.4 C-16499.3 C-18356.2