Summary
Transcript IDgene_000006679
Gene IDTTHERM_00548310
Length942 bp
Sequence
AGAAGTTTAACTAGCTAAATTTATATAAAATGAAAAGATACATTCTCAAACTTATAGATGGTAAAGATTCAACTACCATTCAAAAATGGAAGCTTAAGAAGGACAATACTTACATTATTGGAAGAAGTGATAAGGTAGAAATCCCAATTTAGCAAGAATCTATTTCAAGAAAGCACGCCGAAATCTGCGTTTTAGAAAATAGTGCTACAATTAAAGACTTAGGATCTGCAAACGGTACATTCATAGATGATAAGATAGCAAAACATAATTAAATAATATTCCTTAAAAATGGCACTAAAATTTATTTAGGAGACTCTCCTAATTACTTGATTGTCAAAGAAAAAGAAAGAAAAGCCAAGGTTTCTGAACAATCTTTATAGGAATAAGCCGAAGAATAAGAAGAAGTTGAAGAATAATAAACAAAGGAACAAAAAAAATTGAAAAAGAAAAAAGAATCTAAATAAAAAGAAAGCGATGAGGATGATGAGTAAGAGATTGAATAAAAAAAAGAATAAAAAAAGAAGAAAAGCAGTAAAGAATAATAAGAAGATAGAGAACGTTCTCGTTCTTATGAAAAAGAAAAGTAAAAAAGTAGTAAAAATGAATAAAAAGAACCTTAGACACAAGAATAAAAACCCAACACTTCAGTTAGCAAAGACCTCAATGCATCAGATAAGAGAAAACTCTTATGGCAAAACAAGAAAACTGATAATTTAGAAAGTAAAGCTTAAATATATGGAAAAGTAGAAGCTAATGCAGAAGAGACCAATAAATTTTTTAAGTTGCTCGGATTCAAATCTAGCGCTGATGGAAAGTCTTCAACAGGAGCTAAAGTTCAAAACTATTTTATTACAAAGAGTGGTTCTGATAAATAGACCATGATTAATGATTTAGAAAGTTAATATAATGAAGGTATGAAGAGAAAAAATGGTAACAAGGGAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,402.0 L-21,727.6 L-31,198.7 S-0454.3 S-3563.8
S-6844.0 S-9712.4 S-12589.3 S-15652.8 S-24623.4
C-0617.1 C-2375.4 C-4588.1 C-6293.3 C-8216.1
C-10353.6 C-12395.4 C-14334.9 C-16230.8 C-18178.6