Summary
Transcript IDgene_000006682
Gene IDTTHERM_00548300
Length1692 bp
Sequence
AAATAAATGAATTTTAAAAAGTAGCAAAAGGATTAGTTGATATTTAGTTCAGAAGATAGTTTGAATTCAAACAATTCATTTGCCTCTTCTGTTGAAGATAATGATTAGGAAGATTTTAATAACAATTTTATGAATCTGAAGGATTAAATGGATCACTTTTTCTCCCAAAACCCTCAATTATAAGATGCTATTAAATTTGAACCTTTTAAAGAACCTAATTCAGATGAAGAGGACTAAAATTTAAATTAGGGTATTGATTAGTAATAAAATCATCATAAGCCCACAGGTTTTGATCCATATGGAAATCTTAAAAAATCACCAAAAAAAGACAAACAAAGCTCATTAATAGAGCATAGAAATTTAGAAGAAGTTGATAGGAAAAAAAAAATAGCACTAGATTCGGACAACAACAGTGAATCTGAAAGTCCTAAAAAGAATAGAGAGGTTAAGTTTAATTTAGAAAATTAAAAAAAAGAAAAGTCGAAGTTGTGGACATCTATGACTAAAGATATAATCAGAATGGGCTAATTCGGTTGTAAAACACCAACACTTGAAACTGTTAATCATCGTCTAAATATTTTCAAAAGCAAGATAGAAAAAATTGATTATTTGGAATATTTGTAAAAGGAAATGACTTAAACAGCAGGTGGCCTACTTTCTTAGTAGTAAGCTGGTCAAACGGCTAATGGATAAAATCTTTAATACAGTACAAATCAAAATGCAGCTGCCTCTTCATAAACCAATAACAATGGAGACCAAGCAGATGAAGATGGGAATTTAGCAAATAAACAATCAGAGTAAGAAGAAGATGATGAGAATATTGGAAGAGATTCTGAAGGAAATATTATTTATTTTAGTTTTAAAAAGCGTATGTAGATGGAATTAAGATAAAAAGTTGAAAAATCTCGTAAAATTTAGGAAGAAGAATAAAGACTAAAAAGCAGTGAGATCAAGCAACGTTCTGGAGATAGAAGAGTTAATCTGACCGGAAGAGGAGTTTCTGATGCTTTAAAGTTGATAAAACAATAGCAACTTATAGAGAAAAAAAAGAGAGCTAATTCAGAAGATGAGTTTAGGAACAAAAGAAAAAGTTTCACAGGCCTTAAATCTGAGAAATCTATGGAAAATGAAGAAAAAAAATTGCAATTTGCTGATAAAGATTAAAACCTAAATTTCTAAACAAGAATTGGTATTGCTCTATATTAAACTTATCAGTAATGTGCTGGAGATAAGGAATCGTTTAAGAAAACAGCTAACTTTATCTTGAAGGATTATAATAAAACTAAGGCATCCTTTTTTAAGAAGAAACCATTTCCTCCTCAAACAACAAAATTCACAAACGAAGAAACTAAAAGTTTAAATGTTTATCTGCCAGATTTCTCTTCTAATTTATATGCACCAAATAAAAACAATCTGTTCGCTAATATAGATGCTTTTGAACTTCCTCCTGGAACTCCCGAAGGTGATTTCATCTAAATTGTTGATAAAATTCTAGATGGAGCTGTTCTTCGTTTTTGGAAAGAGTCATAAAACTAACAAGATTGAATGAATAAATAAATAATGAAAAAAAACAAATAAACAAATCAGCAAAAAACATATTCTTCATACCATATCAAAACCATTTTATACCCCCTTATTTATTAATGAAGTAATTTATATAAATAATAATAAAACAAAATCAATCAATCAACA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1775.2 L-2653.3 L-3830.2 S-01,432.8 S-31,147.5
S-61,108.7 S-9977.4 S-12913.7 S-15814.5 S-24909.9
C-01,262.0 C-21,945.9 C-41,227.9 C-6877.0 C-81,080.1
C-102,289.0 C-121,694.1 C-141,465.8 C-161,371.8 C-181,078.2