Summary
Transcript IDgene_000006695
Gene IDTTHERM_00547920
Length2176 bp
Sequence
GAATATTTGTAAATTAGAAAAGATATTGATAAAATTCCTATTCTTAATACTAATTAAAGAAAAATGAATATGATATTTATTCCAGGTACTCTACTCTAGAGCAAGAATAACACATACAGGATAATTAAAACTTTAGGTAAAGGACAGTATGGCACAGTCTATCTAGCTATAGATTCGAATTAATAGCAGTAATTTGCTGTTAAATAGATTTTTAGTTAATCTTTAATAAATAAGAAACTCAATGAATTACTCAATTAGGAATTAACTATCTAAAAGATTATTAAAAGCTAGCATACAGTATAAGTTATAGAAGACTTTTTTGATCAGAATTTTAAAACTCATATAATCATACAAGAATACTGCGATGGAGGTGATTTAGAATAGTATGTAAAAAAATATAAGTACCTTCCTGAAGCTTAAGCGATCTCATACTTAAAATAATTACTTCAAGCTTTTAAGGAATTACATTTCCATAAATGTATGCACAGAGATATCAAGCCCAGTAACATACTTATCTCCTAAGGATTGATAAAGCTTGGAGATTTTGGATTTGCAAAATAATTGAATGATTAAGATATAACTAAAACTGCTTTAGGAACAACTATTACTATGGCACCAGAAGTATTTTACTAACAAGAGTATAGTTACGAAGCTGATATGTTTAGTTTAGGCATTGTATTTTATTATATGCTATTTGGGCAGTATCCATTTAAACCTCAAGGTTTGAATCCTGAGACACTCTTTTTGTAAATAAAAGAATAAAACATTAATTTTAACTTAAATGGAGTAACAATAAGTAGAAATACTCAAGATTTAATAAAATAAATGACAGCATATGATAGAAAATAAAGAATAACATGGCTAGGAATATACTAACATCCAGCATTGCAAGAGTAATCCAGATTCCCTCAAGAAGTTATGAGATATGGTATGGTATAAACTGATAACGTTTTTAATAGAGGAATTAATGAAGAGTTTTATTAATAAAATGGTTAAGCCCTATATCAGCAAGTTTTCAAAAACCAAAATGATGCTCTTGCTTATTAATTCATCTAAATAAAATTTGAAATTTAAGATAATTTACCAAACCAGCCTAATAAGCCTTTTAACTAGCAAAATATTAACTTTGTAGAAGAATAAAACAAGAAGAAACTTCAATAGTAAGCAGAATAACAAGAGAAAGAAAAAAAAATGATCTTATAGCAAAATGAATAAGAATTAGAAAAATAGAAAATGATCTTATAGCAAAATGAATAAGAATTAGAAAAATAGAAAATGATCTAATAATAAAAAGAATAAGAAGAATTAAAATAAAAAATTTTATAATAGCAAATGCAAGAAGAATAAAATAAGTTGTAGCAGCTCATTTAGCAAAAAAATCAAGACTTTGAATTAGGATTGCAGAAATATTTCCACAAAAGAAATACAAATTGCATACTGATTTAGATGCTTAACTCAATCAGAAATCTAAAAGATTTTAAAATTAATTATTAAATTCCTGCGTTTTTGACTTGCAAAAAGCTAATAAAATTGATTAAGGAGTATGGTTAGACTTTGTTAAATAAAAATAATATTTTTGGAATGGTTTATTTTAAAGAATTTGTATAATCAAAATAATATTAAGATCTAATTTAAATGTCGAACAATGATTTAGAGAAAGTTAGGCTAGAATATCCTTAAATCTTATAAGAATGCAAAGACAATATTAATAAATTAAGAATGAATAATGCATAACTCTTATCGCACTTGACATCAGAAGAATGTAATGATAAATTTGAACTTTAGTACAAGGAGTGTTTAATCAATTATTCTCTTTCACTTAGAGAACTAAAAACTTCTGAAGAAACTGAAAAGTAAAGAAATCTCTTTCATCATATTATTCTTATTTCTGATATAGCAAAGATAGATACATTTTAAAAAAATAACTTTAATTTCGACTTTGAAAGATACAAAAAAGAAGTTTACAATACGCCATTCAATGAAATGGAGTCAAAGCTTGATGAAGCTTGCTTAAAAATATTTTCTTGAAGTTCTAAATTTAAATATTATTTCATTCACAATTAATTAATAACTTGATTATTTAATAAATTACAGATAAATAACAGAGATAATTTTTTTATTATTAAATTTTGTAGGTGTATTTTACATAGATTTATAATTAATTGTTGAATAAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,184.8 L-21,230.5 L-31,420.6 S-0226.7 S-31,815.5
S-62,311.1 S-92,095.0 S-121,437.5 S-151,132.0 S-24927.9
C-01,020.4 C-2613.4 C-41,954.5 C-61,455.7 C-81,984.4
C-101,333.5 C-121,249.3 C-141,516.1 C-161,805.4 C-182,469.5