Summary
Transcript IDgene_000006725
Gene IDTTHERM_00678180
Length1669 bp
Sequence
TAAAAAAGTATTTGCCTTATTAAGATAGATATTATGAAATAATTATTAAAAGCGAATTTGAAAAATGGAAGAAAGTCTTAAAGATTTCTGATTTATACAATCATTTTAAGTTACTTGTTTATGGTTGTCTTGTCATAAAACTCCTTTTTGAGTAAGAAAAGGAGTCTTTTTTCAAAATAAGACACAATTAATTTCAGCGGCTCTAAAAAGTACCACGAACCAGGTAGTGCAGAATTTAACTTTGCTATAGCTATGGTTATTTTTTTAGTTATGATGGCAGGCATTTGCTCTGGCTTAAATGTTGGTCTTCTCTCGATTGATGTCGTAGCATTAAATCTTAAGATAAAGAGTGGAACAGAAAACGAAAAGAAGAATGCATAATAAATTTTAGATGTTCTTTCAAATCATCACTTGCTATTATCGACTCTCTTAGTTGCAAATGCATTAGCTATGGAAGCTCTTCCTATATTCTTTCATGAAATAATCCCTGCAGCATTTGCTGTTTTATTTTCAACTATTATAGTAGTCGTATTTGGTGAAATTATTCCATAAGCATATTGCACAGGTCCTAAATAATTCGAAATAGCCTCAAAAAGCTTGCCTATTATAAAATTGTTGATACTCATTTTTTGGATTTTCTGTTTCCCAATAGCAAAATTCTTAGACTGGTTATTAGGCAAGCATGACAGTAGTAAATATAGAAAGAACAAAAAAGATTTAAAGGCATTAATTGAACTCCATGAAAACGGATAGCATGACACTCATTTATAGCAATTTGGATTCAATAAACAAGAAGTAATGATGATTTCATCAACCCTCGATTTAAGAGAACAAAAGGTTACTGAAAAGATGATTAAGTTAGATGATTGCTTTATGCTTAATACAGAAGACATTTTTTCGAAAGAACTCATTTTAAAGATAAAATAAAGCGGTTTCTCTACAATTCCTATTTATGACAAGGTTAGAACTAATATTATTGGATGCTTAAGAACAAAAATTATATTAGGATGCGAAAACAAGCATTTAAATAAGCCTATAGCCACAAGATTCCCTCTAACTTAGTTATTGATGATAGCAAAAGACACAAACATGCTTTAGATGATATAAATCTTTTAAAAAAAGAAATGTAGTCTAGCAATAGTTACAACAGAAGAAAAAAAGAAGAAAAACAATGAAGAATTGTTAATGAGTTGCAGAGATATGATTGTTGAGCATTATAGTCAAATTGAAGGTATTATCTTTTTGAAAGATGTATTTGAAGAAATAGTAGATATAGACTTCTAAGATGATGATTTGCATATTAAGCATGATGAAAAAACTAAAAAAAAGACCAAGAGCACTATGAAAATAAATAACTCCCTACAAGAACCTCTTATAAGCCAAGGATCAAATAAAAAAAACTGATTTATTAAAAATTAAACACAACCATAAAAATGATCCTGAATTAAAAAAAGAGTAAAAGAAACAATTAACATACTAACTAACTAAAATAAATTTATTTAAAAATATTTAATTTCGTTTAATATACTTGCCTAAACTACATAAAAAATCAAAAAATACCTTTAATTATAGTTAAAATAAACATAAATATGCATTTATGTAGGTATATGTATTTTTATGTTGATAAATAATAAATAAATAAAAGTGTTAGAAATTAACTAGAAAAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,634.7 L-24,270.3 L-33,948.6 S-01,690.4 S-32,591.4
S-62,231.4 S-92,305.3 S-122,408.6 S-152,316.5 S-241,941.2
C-02,184.8 C-22,105.9 C-42,052.1 C-67,543.0 C-84,836.8
C-102,191.4 C-121,274.1 C-142,001.6 C-163,386.2 C-182,977.1