Summary
Transcript IDgene_000006798
Gene IDTTHERM_00684450
Length1788 bp
Sequence
CTCAGAAATAAATATAAATTTTATAGAACATTTACAAAAATGGCTGGGATCGATCAATTAATCAACTAAGAGATATCAGACTTTACTTTAGATTCTGTTTATAATAGTAAAAAAATGTTTATGAGCAATTTGGGCTTGAAAGTGCCTGATTTCATTGAAAGTACTAGATTAAAATTATAAGTTAAGATTAATGATGAGTATAAATTTGCTTATGATAAGTAGATAAAAGAGGCTTAAAAATAAGAGGAGCAAGATATCCTCAAGCTTGCAGAATAATTTTATGATTAATCAACAGAAAGTAATGTCCTTCTTAACGAGCAAGTCCAAAAAATGCAAGAAGAAAAGAAAATCAAGGAATTAAATGCTTAGAAAAGAAGCAATATCGAAGTAGTAATTGAATAAATACCTGAAAAGCAAATTGAAATTAATAAAAAGTTATCAAAACTCCCAGCTTCTTTCCTAAAATATGGATAAAAGGCTGGATTAGATAGTCAAACTTTAGAAAAGAAAAAGGAAGAAGAAAGACTTATGCTTACTTATTCAGGATCAGCATCTACTGCTAATAATTAATTATTATCATAAAGTGAGAGAGATGCTTCTAAATATCAAATAGCTAATCTATCTACTGATAACTATGTTAAAGGAGGTGAAGTTATTGATACTGTTAGAATGGGATCTGCTATCGCAAGAAATATTACAAAGGTTATTAAGCCTGAGTGGCATAAACCTTGGAAATTAATGAGAGTTATTGCTGGCCACAGAGGTTGGGTTAGGTGCGTAACTATAGATCCTGCAAATTAATTCTTTGTTACAGGATCAAACGATAGAACAATTAAATTCTGGGATTTAGCCTCAGGATAATTGAAATTAACCCTAACTGGCCACACATCTCCCGTTAGAGCTTTAGTAGTATCTGACAGACATCCTTACTTGTTCTCTGCAGCCGAAGATAAAACTGTTCGTTGCTGGGATCTTGAAATGAATTAAGTCATCAGAAACTATCACGGACATTTATCAAGTGTTCATTCTATTTGCATTCACCCTACTTTAAACTTAATTGCAACTGGTGGCAGAGATTGTACAATTAGATTATGGGATATAAGAGCAAGATCGTAGGTACATGTTTTAACTGGACATTAGCATGCTGTAGGAACTGTTATAAGTTAAGAATTTGAACCTTAAATAGTATCAGGCTCTTATGATAATTATATTAAAACTTGGGATATTGCAGCAGGAAAATGTATGAAAACATTGACAAACCATAAGAAACCTGTAAAGTCTTTAGTTTTTCACCATAAAGAATACACATTTGCTTCAGGTGCAGCTGATAATATCAAGGTTTGGAAGTGTCCCGAAGGAGAATTTTTAAGAAATATATCATCTGGAAATGATCATATAGTAAATTCAATTGCTTTAAATTAGGATAATGTACTCGTTAGCGGTTGTGATGATGGTACTCTCAAATTTTGGGACTGGAAATCAGGATATAATTTCTAAACAATTAAATAAAAGCCATAACCTGGTTCTATAGCTGCAGAAAATGCTATTTTTGATATGAAATTTGATAGATCATAAATGAGACTAATCACTGCTGAGTGTGATAAAACTATAAAAGTTTATAAGGAAGATGATGAAGCTACAATGGAATCTCATCCAATAAATGATTTTAAAGTAGAATATGGAAAGCAAGTTTATTGAAAAAATATTTAAATTTATTTTGAAGAAATTAATTAATGTGTAAAAATTTTATAAAAATATTTAATGTATATATTTTAATTACTATTCTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-15,749.0 L-24,613.4 L-33,682.4 S-02,724.2 S-32,143.3
S-61,709.9 S-91,872.1 S-121,619.0 S-152,072.0 S-242,329.9
C-04,506.5 C-22,494.5 C-41,178.8 C-66,652.5 C-84,874.0
C-103,741.6 C-122,495.3 C-142,149.7 C-163,359.4 C-182,162.7