Summary
Transcript IDgene_000006811
Gene IDTTHERM_00684590
Length1595 bp
Sequence
TTTTAGAACATTAAAAATCAGAATATACATACATACATACACAAATATATATATATAATTTAAAACTCTAGTTTGTTAAAATGGATTTCGCTAAATACTTTTTTAACACCTCAAACACTTCCTTTTTTAAATCCAGCAACAGCAATGAGGCAAATAATTCTAAAATATAATAAAACATTTCGAATAAAAATAGTGATTCTGAGCTATCTGTTTAGTCTAAATAGATTAAATCTAATTCAAAAGATTTATAGCAATCTACAGGCAAGTTTAATGAAACTGCATTTTTTAATAATTAATCAACGAATTCAAGTTAAAATATTTTCTCAAGTTAATACAAAGCAAATATAAACAAGTAAGGATAGTAAAATGCGTTAAATAATATGTAAGTTGGTCCGTTTTAAATAGGAAATAACACCAATGGTTCTATTTAGAAGGCAAACCAATAATAGGAACTAATATTTGATATAAAAGAAAATAAAACATTTTTCCCGTTTTTGAGCTGCTTAAAATAAAAGAAAGAAATTTCTGACAAAGAAAACGATGACCCTAATAATAATGAAAATAAAAATAAATCTCCTTTAATAAACTAACAAGCCTAATAAAATATAAAAAAATCTCCCCCTTATCATAATATTTATAAAGGAACTTAAGATCGTATATTTAATCCTTATGAATGGAGTATACAAGATTTTGAAATAGGGCGTCCTTTAGGATCTGGTAAATTTGGACATGTCTACTTAGCTCGTGAACGTAAAACTAAATTTATAGTTGCGATAAAAGTTTTAAGCAAAAAGTAGTTAATCGATAATAATGCAGAAATATAATTTAGAAGAGAAATTGAAATACAATCTCATTTAAAGCATGAAAACATCTTATAAATGTATGGATTCTTTTGGGATGATAAAAAAATATACCTAATATTAGAATATGCTTCTGGAGGAGAGTTATACAAAGAATTAAAATCTCAACCTCTCAGAAGATTTGATGAAGTTACAGCTGCAAAATATATAAAATAGGTAGCATCTGCTCTAAAGTATTTACACAGTAAGCATGTAATTCATAGAGACATAAAACCAGAAAATTTGCTTAACTGTGATGGAACAATAAAAATTTCAGATTTTGGATGGTCAGCACATGCTCCAAGCAATAAGAGAAATACTCTATGTGGAACTTTAGATTATCTGCCTCCTGAAATGGTTGAACATTAGAGCCATGGTAGTCATGCTGATTTATGGTGCTTAGGTATATTAACATATGAATTTTGTGTTGGTTCTCCTCCCTTTGAAGATAGATAAAATAAAAAAACATATGAAAAAATAAAATAAGTTGATATTAAATATCCAGATTATTTATCATCAGACGTAGTCGATTTCATTTCTCGTCTTTTAACAAAATAACCTTCAAAAAGAATGAATTTAGAATAAGCTCTTAACCATAAATGGGTTAAAATGTATAATGAAAATTGATAAATAAGTCTATTTATTTATTGTCGAAGGATATTAAAGACATATTATATTATTAAGATTAAACAATTTGTATACATAAAATTTTGTGTTATTTATTACTAGAAAAGCTTACTTATGATGGTTTAAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1705.7 L-2670.0 L-3747.0 S-0141.5 S-3314.4
S-6185.5 S-9245.8 S-12210.6 S-15338.7 S-24272.8
C-047.1 C-212,197.3 C-416,746.8 C-615,560.1 C-86,586.3
C-102,170.7 C-122,617.6 C-143,687.1 C-162,521.4 C-18994.2