Summary
Transcript IDgene_000006822
Gene IDTTHERM_00684730
Length1309 bp
Sequence
CTTAAATCAAATGGACAAAATAAATAAAAAGCTTTTCAAAATTTTAGCTGGATACTAAAATTATGAATGGGGTAAAATTGGAGAAAGCAGCTAAGTTTATCAGATGGTCAAATGTTGGAATGAAAGTTTATAATTAAACTAAGCATACGCTGAACTTTGGATGGGCACACATGTAAACTGTCCTTCAATAGCAATTACAGAAAATAATTAGAAAGTTAAATTAGGGGATCTGATAGCTACATAACCGGATGCTTACTTAGGCAAAGAAGTAAAAGAAAAGTATAATTTATAAGATTAGCTGCCTTTCTTGTTTAAAATATTAAGTGTTAACAAGGCTTTAAGTATTTAAGCTCACCCAGATATTGAGTTAGCTAAAAAACTATTTAAAGAATTTCCAAATATTTATAAAGATCCTAACCACAAACCTGAAATGTGCATAGCTTTGACTGATTATGAAGCCCTATGTAACTTTTGTAAGGCTGATGAGATAGTTGAAAATCTAAAAGCTACTCCTGAACTCAAAGAGGTTATAAACAATCAAGAACTAATTGATAAATTTGTTTCAAATAAATCTAAAGAAGATCTTAAAAGTATATTTACTGCTTTATTTGACGCTTCTTAAGACCACATAACAGAATAAGTGAAAAAATTAATTAATAGAGTTTAACTTAAGCAAGATAAAAATGAAAGAGATCTATTGGTTATCAAACTAAATGAGTAATATCCAAACGACGTTGGAATTTTTGTTAGCTATTTACTCAATTATTTTAAAATGAAGGAAGGTGATTGTCTTGTCATGGCAGCTAATGAACCTCATGCTTACATATCAGGAGATTGCATTGAATGTATGGCTGCGTCTGATAACGTAGTTAGAGCAGGTCTAACTCCAAAATTCAAGGATAAAGTCACACTATGCAACATGCTTACCTACGAAATGAAAGATCCATCAATTCTTCGCCAAAAAGTTACTTTTGAAGATAAAAATAAAGGTTAAATTATTGAATTGTATAGCCCAGAAGACTACAAAGATTTTAGCTGTCTTAAAATCTCATCAAAAGAAGGAGACCTCTAAAAAACAGTTAAATTAGAAAGTGGAAGCATATTCATAGTTATTTAAGGTTAAGCTGTAGCATATGTCGATGAAGAAAATAGTGTTAATATACTTAAAGGAGACACCTACTTCGTTCCTGCAAATATTGAGTTTTCATTCAAAAACTCCTAAAACTTAGTAGTATTTGTTTGCTATAGTAGATATTGATTAAAATTAAATTACATAATATTCTCTTTCAAAAAAGAGAGAAAAAGGCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,015.7 L-23,466.7 L-33,294.7 S-0894.0 S-3892.6
S-6520.9 S-9502.7 S-12459.6 S-15468.1 S-24424.0
C-0668.7 C-2576.4 C-4373.2 C-6818.9 C-8883.3
C-10401.3 C-12404.4 C-14403.2 C-16350.5 C-18319.1