Summary
Transcript IDgene_000007025
Gene IDTTHERM_00688340
Length962 bp
Sequence
TAATAAATTTTTGAAATTATAACAGACGAAAGATAGCAATAAAATAAATAAAATACCAAGATATGTCATTCAGAGTCTCTTCTCCCCACAACGAAAGAATAGCTAAAATTAGCGAAAAATTGAGCCAAGTACAATCCAATGCTAATAATGATCGTTCTGCAAAATTAGATTAAGGCGAATAAAGAATTAAATTGTTAGAAGATTCATACACTGAATTCGAAGAAAAGCTTGAAAAAAAAGTCACAACTATTAGAGAAACTATTTAAAAACTCTCCAAGCTTGTTTAAGAAGATAAGTTGAACAGAGAACATCATTTCGAGCAAAAACAAAAAGAAATTGCTTCTCTTGATCAAAAGCTTAGCTCTGCCATCGAAAGTGAAATTGCATCAAGAAAAGAAGGTGAAAATAAAATTACTAGAGCCATAGATGAAAAGACAAGTGTTATTAGAGATGAAATTTCAAGAGAATCTAAAATCAGAAATGAAACTATTGAAGAAATCAACCGCAAGTTAGAAATTGAATTGCCCAAGCTCAGAGATGAAGTTAATAACGAAAAAGTTCAAAGAGAGGAAATGGATTAAAATATTATGAAGAAGACCACTGAAGAACTTGTAAAACTCACTAACATAATATAGTAAGAAAAGAAGGATAGAGAAGAAAGCGAGTAATCTATATTTGATATGTTGAAAGAAGTAGTACACCGTGTAAAGACTGAAATCGAAAATGAAAAGAAGAATAGAGAAATGACAGAAGAAACTCTTCTTGGTTTATTAGAAGACACTTGCAACAAATTAAATGCTGCTGCCCTTGTTTGAACCAGTATAAAATCATACACACACACATACATAAATACTAAAAATAACTTGAAATTTTTGTATATTTTATAAAATTTAATAATAGCTTCAAAATGCACTAAAATTCTTACTGGATTTGTAATGTTTGTTATATATTTTAAGTAATGT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-115,855.9 L-215,600.3 L-315,823.0 S-07,971.4 S-33,839.0
S-63,914.9 S-92,667.3 S-123,189.3 S-152,926.1 S-243,657.7
C-01,377.5 C-21,564.6 C-41,218.4 C-6827.4 C-81,563.9
C-101,820.8 C-121,778.9 C-141,989.8 C-161,829.4 C-181,433.7