Summary
Transcript IDgene_000007036
Gene IDTTHERM_00688480TTHERM_00688490
Length4229 bp
Sequence
GTCAAAAATCATTCAAATTTTGCATAAGTACAAAGTTAATATGATAACAGACTACGATGAATCTTAAGTTTTAATTGAAATAACACCTACGACACTATTTAAAGAAGCATTTAGTGAATACGATGCGTTTATAAGATTGAAGAAATTAGGATAGGCAATTGAAAAAATTACAGATATTCTGCCTTTTGAAAATAAACTTGAATTGATTCTTAGAGAAAAAGAGCTAATAAGATTTTTATTTTATACTAGAATTATAATTCCTGACCAAATGGAGATGCTGTTAGATTCTTTATATAACAAATTTGGATAAAATGCTTAATTTTTAGAAAATTGTTGGGGAAGTTTAGAGTATTTCGCAGAATTACCTACCACGAATATTGAAGATTCAAAGAAGAGAATAGATTTATCGTAATACGAATCTAAAGTTCTCTCTATAAAAATACTTGACACTCAATGTGCTTATATATTCAAAAAATGGACCTTAGAATATGCTTTATTAATATTTGAAACAATTATTAAAGATGCCATCTTCTTAAATAGAAATGATCCTCTTATTCTTTTTATGCATTTGATATAAAACTCAGAAGATTAAGAAATATTATAAAATACTTGCTTAGCACTTGAATAAATTAAGAGTAAGTACCCATTTCTGTGGCATCACAAAGAGGTAGATGAAAGAATTTAAGAAATATTTATGGAGAAAAGCTCTAAGTATTGTAAAATACCTGAGGTTAAGAGGATTGATGTTGAAATAGAAGTAAGGAAAGATGTCAAAGAATTTTTAGATTAAAAAAAATATACTAGGAATAGCTCAAAAAAATAAACTGGTATGCCACTCGTGCTTTTAGAAAAATCTGGAGTGAATAAATTTCTTAACTAAGATAGCGATGACGAAGCAGGAGATGGAAAACTTTAGAGATCTTCAAGCATATCAGATTTAGTTAGTTAATTTCCAAGATAACTTGAGTATTGGCTATATGAAGGAAATTCAGATAAATTGATGATATAAAAGAATGATTTTATCATGGAATCACTAAGAATGTATGAAAATGTGTAAATACTCCTCTCGTTTATTTTAGAGCCAAAACAATACCAAGTTTCAAGAAAATGGGCTAAAAGTATTGCTAATCTGCATTATCATATTGATCACCCTATTTTCTATACACCAACTTTCAGATAAGATTTAAAGGAGCTATATGATGGGAAACCAAAAATTTATAATAGCTATTTCTATAGGAGCTATAGAACTGTTTAACTGATTAAAAATATAAATAATTATAAATTTTTGATGAGTGGAGCTATTAACATCATAGAAATATTTTTTTCTGAATTATATTGCTTATTTTAAAACAATTAATAAAATATTTCAGCTAATATGGAACATATAGGGAACTTGATGAACTTCTTTTTAATACAAAATAATGAAACAACTTTGAAGATGATCATAGAATATAATATTTTATTTAATATAATTCCATATGTAGATATACCTAGCATTAATAATTTTCTTTAGAAAATCTTTTGTGTGAATTTCGTAAGTAAGTCTGATGTAAGTATCGAAACGTACGAGAAGTTTTGGTTATATGCAAAATATACTTAATTCTTTGAAGAGCTATCAAAAATGATGTTATATTGTGATTAAAGCAAATTAAATATGTTTAAATGTGAAAACATGTATAAGTCGTAAGAGTTGTATGACCTTTAAAAATCAATAAATAAAGTAGATGTTAACAAAGTTAATTTTACCTTTAACAAGTATGTCCCTTACTGGCCTGAAGATGATCATATGTTTAGAGTAGACATTGACAAAATTAGGGTTTACAAAACTAGATAAATAAGTTGTAAATTAAAAAAAGCCATCGATTCCTAGAAAAAAGGTTCTGAAAAATTTGGCTCACTAGTGCTATAAGATATCCTACCTTCATTAAGAAAAGGTTCTATTAAAGCCAAAAATGAAGAAACCAAAGAAGTACCTTTTAACAAATAGATAGATTTTAAGCATCGTAATAGTGATCATGAGAAATTTATTCAAATTAACACAGAGATAAATTCAATGAAATAAGCTAATCAAGATTAAAATTCTAGAATTTCTTTCATGGAAAGAATAAATTTATTAAAAAATAATGTAAATGAGCTTCCTTAAATCTAAGTAAATAAAAGTAATAATAAATTAAACTAAGTCTAGAGTAAAATTTTATTAGCATAGAAGTAAGAATAGCCAAAATAAATTCAAGAAAATTTAAGAATTCCAATCTCTTAAATATAAGATTCAGATACACCTTATAATGGATAAAAAACGAAATCTCAAGTATCTATACCATATAAGAAAAGTTACCCAATAAGTCCTATATCTGTTAAGAATAGTCAAAATTACTTAAGTAGTGATATGACAAACCTAAAAGAAATAATCAATTAAAGATTGGCATCTAGTGATATTAGAACAAGGTTCATGACATCAGATAAACTTGAATAAAATAAATAAATAACTAATGGTAGATATGGTGCATCCCCATTTAACAAAAATAATCAAACAATCTAAAAATCGAGCAACTAAATTTACAATGGAAAAGTACTTTTAACTAGTAATGATCAAGGGAATAAAAAGGAAGTATTATAGAGAATAAATTTCCTTTATCCTATGAGTTTAAACTAAATAGATTATTCTGAGATTGAAGCAGAAGCAAAAAATTTTAATACTAAAGATGTTTAAGCAAATGATAGATATAGCGAATCTATAATATGTCTATTCTTTGAAATATATAAAAACATTATTGAATAAGAAAAACAAGATGCTTTCTATAGCCTATTAAAGGTTGTTAGAATTGATTACTCTAATTTAATTTAAGCATCGTTATCTGATAAAATATTCTTAGATATTTGCTAAAATTATTTTTACAAAATAAAGCTGTCATAATCAAATATAACCAACAGTGCACATACATCTCTAAAATTGATAAACTACTTATTATCCAATGTTGAATACCTACCTAATGAAGAGTATAAATTTAGTATGATAAATATTATGGAAAACTATTTTAATTTATAACTAAAAATAATTATGAACTCATATGCTTGGACTTGTAAATGGTAATAAAACTAAATAAGAATTGGAAGTATAGATATAAACTGCATCAACATATTCAAGATAGACATTATTAAAAACCTAAGATTATTTCTTGATCTTGTTAGTCCTGATAAAAGAAAGAAATTCGTTTAATAGATTTATGAATCTACCTGGAGTGCTATTTTATAATTATGCTTTGAGAACAGATTTAACTGTCCTATTTAAAAAGAAGTTTTTGAAATAATTAAATATGGGAACTTCTGCTTAAGCTCTTAGGGGATGATTAATTTATGGGTTAAACTGAATGTCTTTGATTTTTTTAATTAGTAATTAGAGGTTATTTTGCTAAACAACAAATTTAATCCTGCATTTGGTTTACATAATTTTTTCATTTTTATAAAATAAGTTGTAAACTAGCTAAATGAAATGACTGCTATAAGGCAATAAGATCTTTAACAATTTTTGAATTGTATTAAAAATTTGAGTTCATGGAATTTACTGAGAGGGACTATTTTAAATATTAAAAGTCCTTATTAAGATCATCTAAGTATTGATATAAACACACTTGATAAAAGAAAAAGTAATCATTTCTCTCTTGTATAATAACCAGATATGTATAAATTATAGCTTCATACAAATAGAAGTAATTAAACTAGCCATTCAAATTAAAGAACAATAGTAGCATAAACTCCAAATAAAGAGGAAAAATTAAAATTGCAGAGAGAATAGACTCCTATAAAATTTTATAATTCTGGAGCATCAACTGCTTCTAATTCTGTTTTAATAAACAATAATGTATCTGTCTCTGCTTAGCATTTAAATAAAGAATTATATTCTGGTTCATAAACATCTTCTGCTTCACTGAATAAATTTGGAAAACATATTTTATACTAAGGAAATAATAAGATTAAAAGTATGTCAAATTTAGACAAAGATGCTATTGGCTAAAATAATTCTTCAATGAGTTAGTTTAATCTAAGTCAAAATACAAGCACTATTTAGCAATAATAAGCAGAATTATAAACAAGTTTTATTAATACAAAGACTAGTTTAAAAACTGATACAAAATCAAGCAACTTAATTGTAAAAAATAGCTCAATAGGAAATTCTTAGTTGCTAAAATTTAAAATTGTTTAAAATAAATATAATGAATAATAAAATTTGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1101.9 L-2121.3 L-3115.7 S-0133.0 S-379.0
S-674.2 S-986.7 S-1262.1 S-1561.7 S-2474.6
C-096.6 C-23,378.5 C-4917.8 C-6380.3 C-8172.7
C-10388.6 C-12688.8 C-14267.9 C-16145.2 C-18142.1