Summary
Transcript IDgene_000007096
Gene IDTTHERM_00780600
Length1750 bp
Sequence
TTTTTTGATAAATTTATTAATTATTTATAAGGCAATTAGTTAGGCGAAAAAATATAAATATCTTCAATAAAATGTCAAAGAAATAGCAGGCAGATATTTTGTAGCCTAAAAAAGTAACAAATCTCAAAGATTTAATGAACGTAGGCTATTTTGAGTATGCTTAAAAGGGAGATTCAATATATACTTTAGTGCCATATGTTACAAATAAATAGCTACATAATTATACTAAAATACTCGAAAAAAACAAAGATCCCTAAAATGTTTCTGAGCAAAAATAAAAAATAAAAAACGATATTAAAAGGGAAATAGAAAATTTACGTAAAGAAATTGGAGGATGCTATGATGTCTTAAAGAATCTTGGTTCATTTTAAGTAGTTAAAACAGAAAGATTTGATTTACCTGACAATATTAAAGCAAAAGATGTAATTACATCTATGCTGATTCGTAAGCAAGAAATATCAGTAACTAGGAAGATGTTTTAGGATGGTTTATAATCAATTAGAGAATGTCTAGAATAGCAAGAAAATACAATTAAATAGTAGCAAAAGTATAAGCAGTCATTTTACATATCTTAAAGTTCCTAAGTATCTTCTTATAAGCCTTTCCCTTATAAAAAAATTGATAATTAGATTTATATAAACTTCTACAACATACCTATCTTTAATGATAACCAAATCGCTCCTTTAAATATATCCCCTTATTTACTATTCATCCCTCTTCAATATAAAAATGATTAAATAACTGCTAAGTTAGCTGACGTTTACAGAACAACTCCTGATATATTTGAAAAGCAGTTGATAATAAAGGTTGTTAAAAATAATACTCTAGGTCAAGATCCAGAAAAACTTGGGCCAACAATCTAATAAATATCGTTTTTATTTAAACCTTAATTAAGTGAAGAGGATGGGGATGAAGACGATGAATCTCAGATATAAAAGATATATTAACTAAGATACAGAGTATATGAAAGGGTTATTTTTAACAAGTTAATAAATATTTGTAACAAATTCGTCCCTAAATAATTATATATCTACGACACATCAGTCTATCCAAACTTATCTATATTTATTGATGACAGCTATACTCTAAAATTTGAGTTGAAAAAGCTGAGCTAGGAAGAAAAACGATTCTATGATAAGAAAAATTCATACATGTCAAGAAAACAACAAGAGGAAAATATAGCAAACTAAATTTCTTATAGCACTACAAGATCTCCTTATACACTAAATTTATATAGTAATTTGTTTAATTATATGACAAAGATGCCATCACATCGCTCATTGATAAAATATATAATTGAAATTAAGATAACAATTGCTTAGAAATTGTTCCTTTATTAACCTAGATTTCAAATAAATGTCATAAGAAACTAAAATGAAGAAGTTGTTTATATTGGTGCTCATATTAATAGAACTTCTTCTAAATCGAATTAGGAATAGCAGTATGATACTTAACTTAAAATTACTCCTTTTACTACAGAATTTTAGCAATTAAATAAATTGAGCTATACTTTTTCAAATTCTTTAAGCGAAATTCCAAGATTCTGCAAAGAAATGTTATTTGTCTCAGATACTGGTATAATATCTCAGAGAAACCAACTCAGAAATTGGGAATTAGCTTAAATGAATCTATAATAATAGATGATGCCAGCATAAACTCCTTAATGATTAATTCAATTTAATTTGAAATATTTAAATTATTTATTTATTTATTTGTTGCATTTAATAAAAAATAAATGTTAATCTTTTGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1910.8 L-2818.0 L-3713.8 S-0346.7 S-3394.9
S-6445.9 S-9390.8 S-12356.6 S-15408.1 S-24419.8
C-0454.6 C-23,477.2 C-41,031.2 C-6670.3 C-8409.9
C-101,207.5 C-12670.5 C-14508.6 C-16315.4 C-18356.8