Summary
Transcript IDgene_000007138
Gene IDTTHERM_00729020
Length4045 bp
Sequence
ATTTTATCTTTTAAAAAATAATGTAAAATCCATATTTTACTACCGCTAAAAGCAATTAAGCAAATGAAACTGGGCCTGGTAGCTTAAAATATGATTTAAAAAATAAATATGCTTCTACTGCCATTAAGCGTGATGGAACAACCAATGAAAATAATACAAATATATTTGCTTCTTAGCCAGCTAATCAGTAGCCATTATAATAAATGAATAAGGATAACTCAATATTTTAAGGATAGAAATAATTTTAATCCTAAATAAATCAAAGTTAAAGACAATCAAACTAACCATAATACAGTAAAATATTTAGTGCGAATAACTCAATTCCTGCTTCGCCTCATTTAGACCGTCCTTCTGATCGTTTACCAACTCATAACTAATCTTATCTAAATACTAATAATCCTGTAGGAATCCAAATACCTTAACAATATAATTCTATATTTAACTAAAATCCAAATAAAAACTAACCTTCCTTTAGCTATTAGAGATCTGTTCATGGAGCTGACTCCTTTAAGTAGAGTAATAATAATAGCTTTTTGAATTAGAGTGCTCTAAACAATACATAGGCATAAAACTATCATGTTATAGCTCAGTAGAAAGGCTATTAATAATTAGAAGATGCAAAAATATTTAACAGTGATCCTCTCATTTCTAAAGCTGAAAAAACGATAGAATAAATTAAAGAAAACTCAAATATTTTATAAAATATTGTAGAAAAAAGAAGAAAAATATTTTATGATTACGACAGCTGTCTAGATAAAATAGATATTTAAAAAAAGAAACTTAATTAATGTTCTAAAAGTGATTCTAAGCAGTTCTTTCAGCAAAAGACATCACACGAGCTTCTACTATTTAAAGATAAAAAGCAGGAATTAGTGAAGATCAAAGATGAATGCTTGGAGATGATAGGATATTATGAAAAACTAAAACAAAAAGGACTAGCTCTGAGATTGTAAAAGTACTAAAACACTTAAGAGATAAATTATTAACAAGATGTATTTGAATTTGAAAGTATGTACTTAAGAATTCAAGATGAATATTAGAGTAAGACGACTCTGCTAGAAGAGTTAGTTGAAAATTATAAAAAACATTTCAAATTTGATAAGACGAGTGAAAAATTTACTGAAAAATAGCAATAGCTTTCAATGTAGGTCAAAGAAATTGAGAATAGTGATACTATCAATTCAAACTTAAGCATGCTTATTGATGATTTTCTTATTACTTTGAAAGCCTTAATTGAAGAAGTGGAAGAAAATATAGAATTTAATGAAATTCTACTTTCTAGCTATTAAGAAAGCTTCAATTATGTTTAATAAATATTATTTTACAGAAATGAAAAAATTCCTGAGTTAGATAACAAGATTAAAAATATTAGAAATAATATACAACAATATTTAAATAATAGGACAAACCGTTCATAGTAAGCTTCTGGTTATATATAACTAGCATAAAAGGAATCATAAGAAGTTAGGGAATAGTTTAAAAAAATTAAAAAGTAAGCAAAGCAAACTCATTCGTCTTAAAACAGTATGTTCTTTATATAGTTAAGAAGTAAACAAATAACGAAATTAGTAAGCACTATTAATGATATTTATTCAAAAACATTAGATGAGGTGGATAAGCTGGTCAACTATATATCATAAGGATAGCTTGCTAATGATGAGTTATACTGTTAAAATATCATTAATAATGGAAAATAATTACTACTTACTCTCAACGTATAATAATCCCCAGAACAAGGCAAAGTAATGTTATAAAAAACTCAAGTTTAGTTATCTTTACTTCTTGAGTTATAGGATAGACTTTAAAATCTATCTTAATAATCTGAATTTAGTCTAATTAATCCAATTATCTCATAAATGAGCTTGCTTTTATCTTAGTAAATAGCTGAAATCAAAACAGAACAACAAAAAATATTCCCTTTGATAAAATACGAAAATGAAACTAGAGAGTTTAGAATGAAAAGATAAGAAATTCAGTAAACTTTAGAGAAAGCTAAAGAAATCATCAATTTTTAAAAACAAAATTTTATGCTATCTTTTTAATTTGAAGATAATTAGAAGTAATTCTTAAGCATTTTGCAAGTTAATTTGAAATTGCAATAATACTAAAAATTACTGAACCAACTCCTTTAATTTTTTTAAAACTCTCGGTAAGCATCCTACTCACCTTTTGATCCCTAAACAATTACTTAAAACTCATAAGATATCCATCAGCTATTATCAGCCATAGATTACAATAAGACAAACATACATCTTATAACTACTCTACTAGAATCTTGTAATAGTGTATCTCCAACTAGCATAGGAAATTTAAATTTTTAAGTAGATTCAGAAAAAAATAAGCTCTCATCAAATATAAATACTTGTCTATAATTAATTTATAAGTCATATAATAATCTTGAAAATCTGAGATAGGAATATAACAGACCAAACTACATGAACAAAGTAGAGTAAGTTTTACTAAAAAAATTAATTTCCATGTAGTCAATTCTTGTGTAAGTTTAAAATATCTTTGTTTATTGGCTAAAGAGTGGAGATGAAATTACATCAAAAGTAATCCACCTCAGAAAAAACTATGAAAATTACTAGCATCAGTATATTGATCAACGTTTATATGATATTATCTAAGATAATCTTGAAGAACTTGATTTAATGATTTAAGAAACAAGCATCGCCCCTGAGCTATAAGACTGCTTTAAATTTAATATCAAGTCTTACACAGAGTGTCTTGTAAGATATGCTGTTTAATTGGAAAGAAAAGTATTAAACCCATATTCAGCAAATTACTTGATAAATTGGTTGGAAAAAAATTATTAGAATGCTCTTTCTTCTATTACGTATCTATTTGATATGGATGATTTAATTTGGTACTAGTAGGGTAATGATAATGATGATATTGGAATTCAGTTGAAATTGCTAAGGAGTAGGTTAACAGAATCTTTACTTCAATAGCAAAGTTTGGGTTTATTATTTAATCAATAAAATATTATTGCAAATATTAAGCTGGATCTACTACTTTAAGTAGTACTCAAGGATAGCATTCTTTATGATTACAGGGCTATTGAATAGCTACTAAGTATTGGGAAGTTATTTAATTTGCATGTGAGACAAAGCTTTGAAATAAGAAGAGTGCTTGAAGAAAAATATTAGAACACACTTAGTTTAAGATAAAATTAAAATGATTTAGATTAGCTTGTAAGAATTCTATCAAAATATTAAAAAACAGTGGCATTTAATCTTGAAAGAAGAGAGATTATTTTAAAAAGCTAAGTTATGAGTGATGAACTTAAAAGACAAGTCTTAATTTAGGCTGACAAAAATCAAAGCATGCTAATGAATATTTTAAATATTGATTAAAATTTACCTGATAGCATTATGTAAATGTACAACTTTTTAAAATCATACGTTAAAATCTTACCTTTTTTGAATAATGACTCGATTGGCCATGCTTTCTAAGAAGATTATCTGTTTGATTATATCTTTAATTCAAGTAGTAATATTAGTTTACGTCAAGCTCTTGAGTAACATAAATAAGCTGTAGAAATCTTACTTGATGGTAATTTTATTGAAACAGTAAGATAGATTTATTTCAGAGAAAAAGAAATTGTTGATCGAATTAAGCTAGATAAAAAATTAGGATTGTTTGAATACGTTTAAGATTGTTAAATTATAAAAGATTTACGTAGCAATATAGATCTAATTAAATGGAGAGAGATCATTTAAAAATCTATCAATTTATTAACTTAGGATGTCATTAATTCCATCTAAGCATAATAAATTTAATAAGAATTCTCCAGAATAAACTAACTCAATAGAAAATAACAAATATTCGTTAACAAATTCATTATGTCCCAAACATAAAAATGAATACATGCATAAAGAAAAATATCTTTAAACCCTACCCTCTACTTTCATATATAAAATTCAGACCATCAATTAATTTTTCTTCTATAAATTATTTTAAAATTTTTTCCCACTTTTATTTTATTTTTGTTGTTCTATTATTTTAAAAATTGTATTACTCTTAACTATGTTAGAATTAAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1114.2 L-2128.0 L-3122.9 S-0165.3 S-3175.3
S-6155.6 S-9168.1 S-12161.5 S-15153.1 S-24195.9
C-0225.0 C-213,383.4 C-48,181.5 C-62,777.0 C-81,238.0
C-10727.3 C-121,840.4 C-141,515.5 C-16562.4 C-18393.9