Summary
Transcript IDgene_000007139
Gene IDTTHERM_00729020TTHERM_00729030
Length2619 bp
Sequence
CAAACAGTAAAAATTAAAAAGCTTTGATTAGGCTCTTAAGCATTTAAGCCAATAAAAATCAAAAGTAGATATACATTCATAATTACATTTATTTAAGAAGAGCAAATGCTGTTATAGAAAGAAATTTCTAAATCGAAGCAAAAGGAAGCTATGCTCTTTTAGGTTGAATGCTTCATATTTGTTAATTAAGACAAAAAGATAATAAATCTGCAGTTCTTTAACTCTTATCTTAAGGTATTAGAACATAAAAGCGGAAATTAAACAATGGGAGTTGTAGTAATATCAGATATGATAAGAGTAGAGTGGTTGGTAAAAGAAGGTCCAGACGGAACAAATGCATTTGATAGATGTGAAGGGTTCAGAATAGAAAAAGATGATATTTATTAAAGGGCAAAAGCAGCACTAGAAAAAGATGCTGCTTCAATTGACCCGCTTCATTTATTTAATTCATAATAACAAAGCAAAGAAGCCAAATAAGGATAAGCAAATGGCGAAAGTAAAAAGAATTCTACAACGACAACATTAGAAGAATAACAAAAAAACATAGAATAGAATGATTAATTTAGACAAATAATAATAGAGATATTTTTAAAAGAACCAATACTTCTCAAAAAAGTTTACAATTACTTCGCACCTCGTGTTATCATGAAGTAGTTTCATGACCACTACAAAGCTGTAAAAAAGCTTGGTAAAGGCTCGTTTGCATCTGTTTATCTTGTTAATCATAGAGAAACTGGAAAATAACTTGCAATAAAAGCTTTTCTCAAAGAAAAACTTTACTAAGAAGATAAAGGATCAGAAGCGTTTTTCAATGAAATAAACTTAATGAAACAAATAAATCATCCACATTTACTAAAATTGTATGAAGTCTGGGAAAGTATGCACAGTTTTTATTATGTAATTGAGTTAGCAAATGGAGGATCTTTAATGGATCGTATTAGCTTAGCGAAGAGAGCAAAAAAAAAAGGTCTAGAAAAGGAAAAAGATAGTGGAGCTTTTACAGAAAATGAAATTAGATCATATATCAAATAGCTAACTTCTGGTCTGTTGCATTTAAAAGAAAGAAAAATTATGCATAGAGATATAAAACCAGATAATATTCTTCTTAGAAAAGTTCCTGTTTTTTAAAATCTTAAAACACCTAAATCTTAACATCTCTCTGCTAATACTATCCAATAACCTAAGTAATATAAATTTGAAGCAATTATCGTAGATTTTGGATTAGGTACTTAATAAGATATAAAAGAATATTTATTCCCAAAATGTGGAACTCCTGGTTATGTTGCGCCTGAAATTATCAATTTGAAAGGAGATTTAACAAAAGCAAGATATACAACTTAATGTGATATGTTTTCAATAGGAGCAACCTTTTATTTTATGTTATCACTTAAACCTCTTTTCTTGGGATAAACGACAAGAGAGACTATCGAACTAAACAAAAAATGTGAAGTCAACTATAATATTCCAGAACTTAAAGACTGTGATAAGAATGCAATTGATTTAATGAAAAAAATGTTGGAAAAAGATCCAACATTGAGAATAGACCCTAAATCTGCTTTGAAGCACCCTTATTTTAAAAATTTGGACTCAAATTTTGAAGAAGATTTAGTGGTGCCTGAAGATACCCCTACCTAAATAGAATCAGTCATAAAAAAATTTTAATCAGACACGTTTGATATGTCAAGAATTAATTCTTTGATTAACAGTTCTTTAAGATAATAAATGAAGTAATAATCTCAAGAGCAATCAACATGTCTTTCAAATACATCATAAAAGAGCCTATAAATGCTTAATACATTAAGCAATAACAACAATAGCAACTAAATGTAACCACCCACCAGTAATATGTAATATTTAAGCAATACAAGCATGGTATCTAACTTAAACTCGCCTAATATGGCAGCAATGCAGGAATCTACTCATTCTGATTATGAAAGTAGATCTCAATATTCTAATTTTAAGCATAAGGAAAGCATTAATGATTCTGAATTAAACTATGTCAATAAAAATTAAAATGTATATGGTTATATTAGTAAGCAGTTCATCTCATAGAGCAGCTTTGAAAATGATATGAGAAGTCCTTCATTTGCAGCTTCTGAGACTTCTATATGCAGACAAGAAAGTTTGACCTCTAATTTTTCTTTAAAAATGAAAGCACACTAAAATACAAATAAGTAGAAAGATTAAAATAATTAAGTTCGATATAGAGCTCAATCTGTAGAAGATTCTCTAGATCCAGCACATTAAAATAATTTACTAAATCCAAATGGTGCTGAAGGTCGAACTAAGTCACCTTCTAAATTTAAAATCGATTTTGAACGTTCTAGGGCCAGTAGTGACTAATTTGAACACCTAAATTAAATAGAAAATTAAGACGAAACTAGTAAAGAGGCTGAACAGTAAACTTCCAGCAATCAAAATAATTAATAAGGTTAATTATAAAATTAAGCAAAAAAAAATAAAGCAAAGGATGCAGTACCCTAATCAAAAGAAGAAAATAAGCTAAAATTTAAAAAAGGTACATTAGATGAACAATTTTACAATGATCCAAATCTTCTATGAGGGAAAAATATTCCCTTAAATCTGTAATTTTAAATTAATTCCCTTAATGAAATTAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1274.4 L-2308.6 L-3282.5 S-0619.2 S-3320.7
S-6332.8 S-9321.7 S-12300.6 S-15322.9 S-24386.0
C-0341.6 C-2308.3 C-4318.9 C-6136.3 C-8292.8
C-10475.4 C-12429.9 C-14449.2 C-16392.2 C-18423.1