Summary
Transcript IDgene_000007149
Gene IDTTHERM_00729160
Length1801 bp
Sequence
ATCTATAAAAAGATTGACTTTATTTTACTTATAAAAAATAAAAAGTTAATACAAAAAGAAATAATTATTTTCTTAAAGCTATAGAAAACTAGAATTATTTGTTTATAGCACATACCATTTTAAAAGAGCACTATAAAGAATAAAGCATTTTTGATAAATTATCATAAATACAATTAGAAACAACTATTATAAAATAATAACTAGCTATGGACACATTATTAGATAAGAAAGATATTAATGCAAATGATAAAGATTTGCTAAAGAAAAAGAAGAAAAACACATTTAGCTAAAAGGAAGTTTTTAGTGATGGCTATGATACAGATGGGTATAAAGATGAAGAAGATAGAAAGAAGTTAAATTAAATGAATGAAGTTGATAGAGTAAATGAATTGAATAGAAGATTGGAGGAAAGAAATAATAAAAAATTTGATGACAAAATAGCAGAAAAGGCAGAAAAAGTTAAAACAACTGCAGGAGCTGCAGTAGCATCTAATATTTTTGTAGATCCTACCAATGGCTTAGACTAATCTAAAAAGAGTTAAGTAGAAAAGGATAAAATGCAGCTAAAAAAAGAATTAGAAACAAAAAGAGAAAAGTTAAAAGACTCAAATTCTCATTCTAATAATAATAATGATTATAATTTTTCACAATATGATGATTTTAAGAGTTAAACTCATGGTCTAGCTCAGCACTAAAGAGAAAGAAATACTTAGAGTGAAGAATTTTAAAAATTAGTTAAATAGCTAACTCTCTCAAAAGATTATCTAAACAAGTTACTACTTCGTTCTTATTTTCATGAATTAGTTAAGGGAGTATATGTTAAAGTTAGAATAGGAACAAAATACGAAATCTATAAAATAGAAGGTGCTCATTCTGAAGGTAATAATACTGTTTTTACATTAAATAATGGACTCAAGACCAGAAAAATAGATTTACAATATATTTCAAACTAAAATCCTGATCAAGTTGAGCTATGTACTTACTATGAATAAAATAAACATGAAAAACTTCAGAGCTTAGTTGATAAAAAGAAGTAGTTTGATGACTTGATAAATAAAAAGTAAGAAAAGAGTGAGAAGCAAAAATATTAAGAGATAGACTAGCAAATTTCCTAAAAAATAGAGCAAGGATATTATGAAAAGCAGAATAATTTAAATGCTAATGAAATTTAAACTAATATTGGTTTTTACAAAGATAGAATATTAGATATAGATTATATTGAGCAAAATTAGATATAAGTAGGTAAGTCAGAATTGGAAAAGCTCTAAAAAGACAAAGTTAGATTTTAAAAAAATGTAGAATACTTGTAAAAGTAAATTAAACTTGTTAAGCACTAAATAGTACCAATTTTTACCAAAAATGTTCTTGAAATGGGTTCTAAAATCAGTGAATAGGCACTAAATAAAAAAAATGCAAAAATTAAAGACAAAGCCATGATAAGAAGATAGAAAATTCAAAAATTACAATAACCATATTTTGCCTTCGAAGAATAATTCAAGCAACTTTCTCAATACTCTACATCTATTTTATTGAAGGAAATAATTAAAAATAATCATTCAAGCTTGCACCTTTCATCCTAAATATAAAAAGACTTAAGTCTTATTGATTGTTCTGATTAAACAATGCAATCTTTGATTTCTAACAAAAAATGAATCTTTCAATTTCTCAAAAAATCAAAAAAGTAAATAATCTCAAACAATTTTTTCAACATAATTGAAGTTAAAACGATATTAATGTATTTATTTATAGTATTCACTTGGTTGTTTATTTTATTTAGATACAGAAAATTTAATTATTTAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,364.3 L-21,160.5 L-3851.9 S-01,123.5 S-3877.8
S-6874.7 S-9744.5 S-12796.2 S-15819.1 S-241,089.0
C-01,061.3 C-2784.4 C-4923.5 C-6720.8 C-8807.6
C-101,243.1 C-12856.1 C-14828.7 C-16703.1 C-18554.3