Summary
Transcript IDgene_000007246
Gene IDTTHERM_00836690
Length1709 bp
Sequence
AAATAATAAAAGAAAGGAAAAAGAAAAAAATACAAAAAAATAAAAAAATTAATTAAGGGCAATAAATATGTTATCCAAAATTACTCAAAACACCTTGAAGTCTCTCTCCGGATAGTGCAAGCAAGCTTTCTCTGTTAGAAAAGCTTTCTACGACTTCATTTACAAGGATGACAAGTCTGCTGAAACCTACAAGGTTACTACTGCTGACCCCAGAACTCCCGTCTAGGGTTTCAGAGGCCAAACTGCCGAAGACGTTGCTGCCAAGTACGAAGTCACCAAGCTTGCCAACGGTGTCACCATTATCACTGAATCTTAAACTTTCCCTTCTCAAGTTGATATGGGTATTCTTTTGGACGTCGGTACCAGAGATGAAACCAACGAAACTTCTGGTTCTTTACTCTCCATCAAGAACACTTACCTCAAGACTGTCTTGAACACAAACGAAACCATTAACTACGGTGTTGTTCAACAATCTGGTGGTTCTTTCGAAATGGAATATGACTAAGAAACTGCTTACTTCAAGGCTAACTGCCTCGCTCACGATGCTACCGATGTCTTCTCCATGGTTGCTGACTGTGCTCTTGAACCCAGATCTACCGTCGCTGCTTCAGTCGGTGTTGAAAAGAACTAAAATACCCACAAGCTCGAATCTTACCTCAAGACTGGTGAACTTTTCAACGAAAGCGTCTTCAAGACTGCTTATGGTTTGAAGGGCTTAGGTTTACCCCTTAAGGGTTTAAGAGGAAACGTTAAGAACTTGTCTTCTTACACTTTATAAAAGTTCTAATTGGAAAACATCACCCCCAACAGAATCTTCGTCTGCGCTGCTGGTGTTGAATCCCACCAAGAATTCGTTGACCTCGTTCAAACCAAGCTTGCTTAAATCCCCTCTGCTGAAGGTCAAAAGACCCACCAAAGAGAAAAATCCGAATATCTCGGTGGTGAAGTTAGAAACTTAACTGAAGAAAGCAACGTCACCCTTGCTTTATTATTCTAATCTGTTCCTTGGAGCTCTGCTGACATAGTTGCTTTCAACGTTGCTGCTGCCCTTCTCAACAACCTCAGACTCAAGAAGAACCTCTTATAAAAGTACGCTTACTTCGATTAAGCTGAAGCCTTGAACTTCCACTTCACTGACTCTGGTTTATTCGGTCTCAGAACTTCTGGTTCTGCTGATAGAGCTAAGGACATTCTTAACCACAGTATTGCTGAATTGAAGGCTATTGCTTCTGGTGTTAATGCTGATGAACTCCTTACTGCTAAGGCTGCCCTTAAGAACTCTGTTCTTTCTGCTCTCGAAAGACAAACTGACAGACTCGAAGAAACTGTCAAGAATGTCAGAACTTTCAATAAAATTCAACACACTGATTACGTTAAGCAAATTGATTCCGTTACTGCTGATCAAGTCGCCAAGGCTGTTGCTAAGGTTTTGACTTCTAATCCTACCTTCGTTGCCCAAGGTAGTCAAGTTAATGCTCTTCCTACTTATGATGCTATTAGAAACCTCCTCAAGTGATCATGATACACTTTTTTATAATTTATTGATAAAATTAATAATTGCAATATAGTGCTACGTTATTGATTATTGCTCTGTAGCCTCAATTTGTATAAAATATTAATCATTTTAAAGTATTCTACATAATTGAGTCAAGAGTTTTATCATTCGTACAAACTTTATCATGCTGATGACAATAATTGTTATATAATTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-152,247.4 L-255,164.7 L-353,369.1 S-051,942.2 S-332,250.7
S-623,794.3 S-924,994.2 S-1224,485.7 S-1525,292.1 S-2423,820.1
C-023,521.3 C-217,474.6 C-423,367.3 C-619,958.4 C-824,344.9
C-1024,350.5 C-1229,141.0 C-1419,696.3 C-1618,686.4 C-1816,447.6