Summary
Transcript IDgene_000007257
Gene IDTTHERM_00837970
Length3245 bp
Sequence
AAATAATTAAAAAGCAGAAAGAAATGAACAATTAGAATGAAGAACACAAAGAAAGTGCCAATAGCAGTTTATTGTCTTCAATGGTCAACGCATTGGTAATTATAACAGTTATAGCTGCTATTATAATTCCATTGCTCAAAAACCTGAAGGAAAAGTTTTTTTAACAAAATAATCGTGCTAATAGCCCTTAATTTTCTTAATAAAATAAAAATCAATCTTCTCCCATTTAAGGCTTACAAAACTTTCATGCGAATAGCGAAAATTAAGGTTAGGCTAATCAATTTTATTCAGATCAATTAGATAATACTCCAAGTACAGCAAGTTATTAGCTGATATAAAGAAGCTAAGGCATCTAGCAGTGGAACGATAGGAATGAAAGGTTTAAATAAATTCTTGATTAATAAGAGAATCCTGTCACTAATATCATTGATTATAATACTCAGGTTAGGAAATTTATAGGATAAAAGATCTCCTTTAATGTAAAACTACTTTTTGAAGAGCTAAAAAGTAAAAGCTTAGAGGCAAACTGCTAAACTTATGAGTACTTATTACAGATTTTATTAGATTGCAAACAAGTCGAAGGCGCGTTAGATCTTTTTGCTTTATTTTAGACTTAATTCCTAAAGTTAGAAGTCATAACTCCCAACATTATTTGCCTCTTTCTAAAAGCGATTTAATATGGACTGAATAATTAAATTTCAAGTTAATAAAGCATTTAAATGGTAGAACAGTTGAACTCAATTGTAAATAAATATAATTTGAAAATGAACGAGGGAAGCGTTATTGCTATGATTGATATTGCTTTAAGATCTAATAAGTTAGCATAAGCTTTGTAGACGCTTGATAATTTAGAGAGAGATGAAACATGGAAAGCAAAAGAAGATATCTAAAAGAGAAGGTGTGAACTATATTACTAAATACTTAAAAACCTTAAAGGAATCTAATATAGCGAAAACGATGAAACATTGTAAAAGTTATGTTAAATGGTTGAATATTTGAATGAAAAGAAAGAAGAAGAAAACATATACCCTGATGAGGCAATGATTAATTCCTTAATAGATTTATGTTTCTAGTGTGGCTAAGTAAAGTTAGCTCTAGATGTCTATGGATATTTTGATAAATTTGGTGTTTCACCTTCTGGAGTAACTTACTGCATACTAATCAAAGGTTATGGCTAGCACAAATAATTTAATTATGCTATGACCATTTATTAGTAAATGAAGACAAATAAAATTTCCCTTAATGAAGTGACTCTAGGATGCTTGATAGATACATGTGTTAAATGTAATTAACTCAATAAAGCAGAAGAAATACTCTTAGAAGAAAAGGACATAAAGCCTAATACAATCATTTACACAACTTTGCTCAAAGGATACACAAAATAAGAAAACATGAAAAAAGCCTTAGAAATATTTGAAATAATGAAGAAGGATAAAGATCTAGAACCTAATATTGTTTCTTACAATAGTTTGATGGAGTGTGCTGTTTAGTGTAAAGACAAAGAATAGATGAAAAAAATTTTCAATGAGATTATGGAATAGAAAGAAGAAAATAAAAGAGCAGACTTGATTACGTATAGCACTTACATTAAAGGGCTTTTTAAGCAGGGAGACATTGAAGAAGCTTTAGAAATTTTTGAAGACTTGAGAAAATAAGAATAATATAAGCTTGATGAAATTTTTTATAATAGTATACTTGATGGGTTGTTTAAGGCTAGGTCATTCGAAAAAACTTAATTGCTTTATCAAAAAATGAGACAAGACAACATTCAACCATCTAACGTTACTTATAGCATTTTAATCAAGCTAAATAGTGCTTAAGACAAGGTTGATGAAGCATTAAATATCCTAAAAGAAATGAAGAAAGTCAGTATTAAACCAGGTTTAATTGTTTACACCTGCTTAATCTAAGCTTGCATTAAACATAAGCGCATCAGAGAGTTACTTCCACTATATGAAGATATGAAAAGAAACAATATAAGAGGTGATCCTGTCTTTTACAACACTCTCGTTAGTGGTTTAATGTTCAATAATTGCGTAAATGATGCGCTTAAAATGACAATTGACACTCTAGAAAAGAAAGTAATTTTGAATCAAGAGGTGTATCAAAATCTTCTGACAAAAGTTTTAAGCAAGAGAAAGGCTATGGAAAATACTCAAAACAGCGGGGAAAATAACGAAGTAGAAGACTAGAGATCGAGAACATATTCAGGAAATATTAGATTTACATCTAATTTCAATTAGATGAATAGCTAAAATTTTGAAACAGAATAGTTGACATTGCAAGAAATAGAAAAATGCTTATAAAAAATGTTAGTTTTACTAAAAAAACATCAGGTTGAAATAGATATTGATCTCTACAAGGAAGTTGTTAATTAAATCTTTGTTAATAACAATGATGAAAAAAAGGAATATCTATAGTATTTAAACCAAAAGGGATCAAACAACATGAACAGATAATATTGGGGAAATAGAAATAATTTAGGTGGTTTTAGTCAAAAGAACTCTGGTTTCTAAAATAATTATAACAATAATTATTCTACAAATACGAATAAAAATAAATCTTAGTCTTTTCACTAAAGAAAGAAGACAGATGATTCTCTTCTTTTTAATAATGGATCGTCAGTCTCATCTTAATATAATAATAATAACTTGAATTCTAGCTACAATTCAAATAAAATAAATTTTAGGACAAATAGTGGGTTTGAGAATGGAAATAACAATAATAATCATAATATCAATAATAACTATAGCAATCCCAAAGTCGGCAATAATCAAGAAGGAAGAAAATTCATTAATAAACCAAAAATAGGAGGCGGACCTTCTATTGACGATTTAAAGAATAAGCTATAATTGAATGGTGATAATTCAGTTTAGCAAAATAAATAGAATAAAAGCGTATCTAAGAATCAAAATTCATTCCTCTCTAATCGCAGTGAAAAGGATGAGATATAAGATTAGTTATTGAATGAAAAGAACTTAGAGTAATTTGAAAAAGACTCTGATGATGATTCCATTGATTCCAAAGGAGAGCATAAAAATGACAAAAATTAGAAGAAGCAGAAAAAAACTTACTTCTCTAAATCTAAAATTTCTAACTCACAAAATAATAACTCTTGATTGAATAAACTCCAGAAATATTATTAAAATTTAAATAGTTAAAAGTACATTTTTAAAATAATTTAATGTTAGTATTCAATTTTAGACAGCTTGCTTTAAGATGTATTTAATATATTTATTAATCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1481.7 L-2385.2 L-3460.9 S-0769.9 S-3789.0
S-6522.6 S-9508.5 S-12524.0 S-15648.7 S-24966.3
C-01,142.9 C-25,714.3 C-41,855.5 C-65,703.8 C-87,368.7
C-102,511.8 C-121,429.0 C-14740.0 C-161,946.4 C-181,440.5