Summary
Transcript IDgene_000007277
Gene IDTTHERM_00705190
Length701 bp
Sequence
TAAATTTATATATTTATAGTAACTCTAAAAATTAGTAAATAACAATTACAAGAAAAAACCAAAGGTTAATAATAGTAGCTACTACTTAGGACATGAGATTGCTTTCCCACAATTTACTCTAGTGCAACGTTAAAAATTGCAAATCAAATAATTTCCCCTTGAAGATTTAGGTCGATAAATCCAACATTATAAATTGCGAATTCCGTAAGGAACCTCTTGTTAAGCTCATTCCTAAATTAGATTGGAATGCCTTAGCTATTACTGTCCATAATCTTGCTAAGAATAAAGAATTCCCTGAAAAATTTAGCCCTGCTCTCTTAGATGATTAAAAGTTTATGCAAGAATTACACAGAATTTTGATGGAAACTCATATTATTGAAGGTGCTTTAATCTGTGAAGGTTGCAATAAGAGATATCCCATTAAAAATGGTATCCCCAACATGATTTTAAATGATGAAGAAGTTTGAAAGGTGAAGAAAGGAATAAAAATACAAATATATTAAAATATAGGTTCATTTAATTTAATAAGTAGCAAATATCTGGCTGTTTTGGTGCATAAGATAGTCAAACTCTATACATTTTTAGGGATCGCTTTTTAAAATTATAAATAAGTTGTTTAACATTATAAATTAAATTACAAGTATTTTATTTATGTTTCCTCTAAAAATGTATTTAAGTTTGGATTTCTTTCATTCATTCCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,344.3 L-22,561.0 L-32,320.3 S-0426.4 S-31,004.3
S-61,261.2 S-91,146.8 S-121,279.8 S-151,432.6 S-241,459.5
C-02,655.2 C-2782.1 C-42,793.1 C-61,472.9 C-81,176.1
C-101,324.2 C-121,048.7 C-141,620.3 C-161,556.6 C-181,385.1