Summary
Transcript IDgene_000007297
Gene IDTTHERM_00931900
Length3231 bp
Sequence
AATAATTAACTCTTCCTACATAAAATTTCATAGCAAGTTGGTTAGTGAGTCTGAATAAGTACTGATAGATAAATAATATAGACCATTATTAATATGGATAAGCACTCAAATTTTTAAGAAAGCCAAGAGCTAAGAAAACCTTTAAATATCAATGCTGTAACTGTAGAGCAGTATAAGAACTGTTTTATTATAAAAGCAGATCCATTAATAACAGGCATTGATTCTAGCTTATAAATTGATATAGATACAGGAAGAATTTAAGAAATAAAAAAAGATTAAAAATTGCCATAAATGGGAGAAGCGCCAAAAGAAAAGAAGGGTTGTGCTTTTTTAGGACTTTTACATATTAAATTCCATCCATTTTTAGTTTTTGCTGGAGAAGTTAAACCAATTTGCACAATTGAAAACAATTAGGTTTATGAAATTCACTCTATTTTCTTCAAAGCATTTCATAGATTAGATTACAATGAAACAAGCACAGGTAGAAAAGTGCTTAATTTACAAAATCATTTAAAAAAGCTTTTCTCTAGTGGTTTCTATTTTTCTTATTAGTTTGATTTAACTCTTTCTAAGTAGAAAAAATCCAAAGGAAATTCTAAAGAATCTTCTTTTGCTTGGAATACTCATTTAATGAAGGATTTATTTTAATAAAATATTAGCTAATCATGGTAGCTTTCATTAATTTATGGCTATGTTGGATATTTTTATACAGTAGTTAACAAAAAGAGATTAGATTATTATCTGATAAGTAGAAAATCTCGCCATCAAGCAGGAACAAGTGTAAATGTTAGAGGATTAGATGATGAAGGAAATGCTGCTAATTTTGTTGAAACAGAAGTAATTATATACTATAATAAATTCTGCTGCTCTTCAGTATATGTTAGAGGCAGTGTTCCTGTTTTTTGGTCCTAGGAGAGCTCAGTAAGACTGAGCTAATATGATGATATAACTCACAATGCATTCATAAAACATTTTGATTTGCTAAGAGAATAGTATGGTAAAGTTATGTGTTTAAATTTGATGAGTAAAAGTAAAACAAATGAACAAATTCTTACTGAAGCTTTTGAGAACCATTTTGAAAAGGCGAATTTTAAGAATCAAAAGTATTAATATTTTGATTATAATGGCACTATTAAAAATAATAAAAATGATTTATTTAATGATCTACTAAACAAAAATCTTAATGCTGTGATTTAAAACTTTTAGTTTTATGCAGAAGATGGAAAAAATTGGGAAATAATTCAAGACCAAATAGGTGTTTTTCGTATAAATTGCTTTGATTGTTTGAATAGGTCAAACTAGGCCATGTTAAAAATTTCTTTAAAAATACTTTAACAACAAATGAAATGCTTAAATATTTCAATTCCTAATTTTAATACTAAATCTGACTCTGATGTGCTTACTAATTTCGATACATAGGTTTTAAATATGAGCAATAATAAGCAGAAAGTGAATTAATTTATATATAATTTATAAGAATTGTGGGATTAGAATGCTAATTCGCTTAGTAGAGCGTATATTGGAACAGATGCCAATACATCAAATCAAAAATAAGGATTTTTTGCTTTAGTTGAACAAGGTGTAAAAGGCATCAATAAGCTCTATCAATAAAATTTTGAAGACTCTGCTAAATAAGGAAGTATAGATCTTATTTTAGGATAAACAATCTTCTAAGATTTATTTAATGAGAAAATCTTGAAGGTTCTAAAGAAAAGAGAATAGGATTTTACTACATTAAGCAATTTAAATGTATTCTGTATGACATGGAATATGAATGGTAATGAACCAGATGCTGAAATGAATTTTGCATAAAACATATTTAATTTTGAGAAGTAACCAAACCCTGATATTGTTGTTATTGGTCTTCAAGAAATGGTCAAGCTAAATGTGCAAAATGTAATGATGACAAATAATGAAAGAATTATTTAAACTTGGCTAGATTATCTGAATAAGTAACTAAATAGCATAAGCAGCGAAGATAAATATAAAATGTTAAAGTGGAAAGATCTTGTAGGTATTTTTATGGTGTTATTCGTTAAGGAACCTTTAGTCAAACGTATCAAAAGACTAGAATCTGAAGAGGTAAAAACAGGTTTAGGAGGAAAACTAGGTAACAAAGGTTGTGTTATCATAAAATTTACTGTTGATGATTCCAACATTTGTCTTATTAATTCTCATCTTGAAAGTGGTTTAAAAAACAGTATGGATCGTATTAAAAATATTTAAGAAATTCATTAGAAGCTACTGTCATCAGATTAAAAAAGAAAAGACGGAAAAAATGATTTTGACTATAGAATATTTATGGGTGACATGAATTTTCGTGTTTAACTTCCAAATTCCGAAACTCGTATTCAGCTTGATAGGTATGAAAATTCTAAAAAGCATTCTAAATAAGATGCACAAACAATTTTAAGAGAGCTATTGAAGCAAGATTAATTAAATATTTTGAGAGATAAATCTGAAAAGCACGATTACTTATCTAAATATCAAGAACACTAAATAAATTTCCCTCCCACATATAAATTTGATGTTGGGACAAGGAGGTACGACACTTCTAAAAAAAATAGAACTCCTTCTTGGTGTGATAGAATTTTAATTTGGCATAATGAAAACCTTTTAATCAAGCAATATTTCTACAATAGCAAAGAATTACTACACTCAGATCATAGACCAGTAGTTACTTATTATAATCTAGAGATCAAAAAAATTGACTAAGAAAAGAGGGCATAAATCATAAAAACTGTTTATAACTAGTCAGAAGATGATATTGAAGAAATAGAAAAAATAATGGATGTATATAATTTAACAACAGGTGTTAATACATAAACTCTAGGATCTAAAAAGTTGATACCCGTAGAAGAATATAATACTATGGCTAAAGCAAATGGAAATTAAGAAGATAATGATAAAATGTTTTAGTTTTACCAAACTTCAGCTAACTTTTAGCACAATTTTAACTAACAATAACAACAATAATTCGGTTAATTTAGTGTTAGTTAAAACTAAAATGCAAAAGAAATATAAAATAATGCTTAAAACACAAACTAGTTTTAATATTCTGATCTTCATAATAATAAAGGTATTTAAACAATAAAGAATGATCTTATTTTCTTTGAACCAGATCAAAGCTCATAAATAATTAATAGCTAGAATATACAAAATATTGAATTTAGTGCAGATTTTAACAACGAAAAATATGTTAATAATTAATATTAATAATAGTAGTAATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1300.8 L-2245.2 L-3207.5 S-0353.1 S-3239.9
S-6143.5 S-9131.6 S-12169.9 S-15166.5 S-24256.4
C-0225.0 C-23,673.1 C-41,857.4 C-61,097.8 C-81,325.4
C-10320.1 C-12405.1 C-14276.1 C-16321.8 C-18248.5