Summary
Transcript IDgene_000007411
Gene IDTTHERM_00849500
Length3730 bp
Sequence
ATCTATATAAAAAAAGCCAATCAATCAAATATAAGAAAATTGTTTATAAATATGGTTTACATACAAGCTTTAATCTAAGAAAAGAAAGAATAATTTTAAGGCTTGAATGTAGATTTAAAAGAGTTCAGAGAAATTCTTCACAAAATAGGAGAAATAAATACAAAATATGCATTGGATGAAGAAGTTATTGTCTAGCTATACAATGTACTCTTCCAAAAATAAGAAGGGTATGTAACAATAGAGGGAATAGAAGCCCTTATTCTTTAATGCTTATTAGAGGAATAAAGCTAATACTAAAAAAATGAGTAATAAAGTTAGGATTTAGATTAGTTAGAAATTAAGAGTATGAAACACATTTAGCTTGAGGAAAACTGTCTTGTCTCAACCTACTAGCACTTAAATTTTGATTCTATAAATTAGATACTATTTATTTATAACAAAGCGCTCAAAATTGCCAAGGCTTAAGACTAAGATAAGTGCGAGTTACAATTAATTCTTAAGCAGATAGACATTTTGAATAAGTAGGGCAAGTTATTACTTGATAGCGATTTAGCTAAATAAATATTTCAAATGTTAAGCTGTAAAATTGAAGAGAACAATTAAGATTACGTTTTTAATAATGAATTATAGTAGTATATAAGTAAATATGAAAACTACATTCTACTTAATAAATATGGTTAGAATAACATAGAAAATTATGAGTAAGCATATGTTTTCCACGAAAGTGAAGAAGAATGCACAAGTTGTGACAGTTAAAACAATTCTTAAAATGAAATAAATAAAAGAGGTACTGAAAATAATTCTATGGTAGGACAACAAAAAGATAGTAATTAAGATAAAAAAAGTTAGCAAATATCAAATTAACAATTTACCTCAGTCATTAGCTCACTTTCTAACATATAAGATATGAATTCTTATAAATATTTAGATAATAGAAATTATTTTATAGAAAATAATTATGTGTAAAGCATGAGAGACTTATATCCAGTACTAAGTGAATTTGAGTCTAAAGATAAAAATTACAAAGGCATAGTTGAAAAAATTTAACAATTTTATTCTTCTCTTTAATAAGAAATATAGAATTTATAGTAGCAACTCTATGAAAAGGACAGCTAAATCTAACATTTTGCTGAAATTAAGTCAATGAAAGCCTAAAGAATTAGTGAAATGCAAAAAAAAGAAGAAGAATACATACACCAAATTTCCTATCTCGAAGATAAAATATGTAATTTATAAGAAAATATTGAGCAGCTTAATAAACAGATAAAAGAATATCAAAGCAAAGAAAAAGAATATAATCAAATTGAGTAAGAACATGACAGATAAGTAAAAGAGTTAAAAAGCAAAGATTAAGAAATAAAGGAATTAAAACATTAACTTTTTGAATTAAAAAAGAACTTTCATGAGTCAAAATAAACCTAATTGTCATAAGAATAAGAAATTCTACATTTAAAGAGTAAAATAGAGAAGAGCCCTGCAGAATCGCAAAATAGTTCTTTGTATAGCACAGAAAGACAGAATTTTGAATAGCTTAATGGTGTTATTTCATATTTAGAAGATGAAAATTCTCAGTTAAAGTAAGAAAATGAGCAACTGAAATAAAAAGTTTAGCATTATGTAAAAGTAATTGAGGATAATGAAGAAAGTAATAATAATTTATAATCAGAAGTATTTACTTTAAAAAAGCAAATAAATGAAATAAATGATTCCTTTTGCAACTCTCTAAATGATATAAATTTAAGTACTAAGTAAGAGTTGTCCATTTAGCAGTTAGCTCATAGAAAATCAAAAAGTTTATTTAATAGATTGTCTTGGCAAGCTGAAATATAATAACTAAACAATCCCTATACAAATGATAATGATTTGGTTTAAACAAATTTGGAAAACGATCTAGAATAGATTTTGTCAAATAAATAAATAGAATCGGAAGAAAATACTTAAAATTAAGTAAAATAAAATGATAATGATCAATAAAAAACTGCTTCAAAAAAATAACGCACTAAATAAATTTCTTTTTAAAATTAAGAAAATTTTTTAGGTGATATATTAAATGATACAAAATAGAATAATAAGGTAGAGTAAGTTAGAAGCGGTTTTAAAAGGACTAATTGCTTCAGTTTTGCAGCTTTAGAAGTTATTTAAAGTTATCAAAAACTTCAAACAAAAAAAGATGTCTTGGAATAGGAGTAATATTAGAGATCTCCAGAAATGACTACAAGTTAAATACCTAGTATTTAATCTACTAAAATGTAATTGAATTAAGAAGACTATATGACTACTAGCGTGTAAGTAATGTAGACTAGTATATAAAAACAAAATGATGAGAATAGATATCCTGAAAGTAAATGTACAATTCCGAAAACAGAAAATACTTAAGACAAAGTGACGCCAAGCTTTTAATAAATGTTGTAAGGTGATACTAATTTTTATTGGAATTAGTTGAACAAACAATTGTTTTCAAATAACTAAAATAAATATAATCAAAATTTTATTGAAGAAGAAAATAGCATTAATGAAAGCAGGAAATAGATTACTATTCAGTAATTTAGTGTATTATAAGATTTCAGCAGAGGTAAAGAAAATAATGCATAGACTTAAGGTTTTTCCTTCCCATAAGTAAACTAACTTATCAATACAGATAACTTAAATTTAAAAGAAGATCCTAGAGTTATTTAAATTAGAGAAACATACGAATCTAATTTAAAAAGAAATAGCTCAGAAAATACTTTGAAGGAAAATACGAATTTATGTAAAAACGATACAAATTTATCTGTTGAATATTTTTATTCTGATTCCATATATAGAATTAACGCTTAAAATGAAAAAGAGCGCAGAATTTTATTTATAACTTCTTAATATGTGTACATCATTAATCCTACTGAAAATTTTAAGATAGTTAGAAAATTTTAAGTGCGATTAATAAATAGAATAACTTTTAGCAACATAAGTTCTAATCTTTGCGTAATTCACGTATTGAATTAATCAGATTACGTTATTGAATCTTGTAGAAGGTTTGATTTGAATATATTCTTAAAGAATTTATTCAAGGCTCTAAATTTACCCACCTATATGATTTCATTTGCAGAAAATCTTTTAATAAGATCTAAGAAAAAAGATAAGATATTTAAGTCCCCAGTTTAATCTGTTTAAAACGAAAACACCGAAAATTCATTAGGTACAGATTAGAACAAAATGAAATGTTTACCACCTCAAAATGAATCTACGAGCATAGTAAATAAGAATATTCTGGAATAAAAAATAAATGCTAATATCCAATCTAATAGCTTTAATAATAAATTGTATTTTTTCAACATCTAAATGAAAATTAATTAAAATATGATATCAAATTTTTTATTCAATCCATGGAAACCATATCTATTATAAATAAATAATACCCAAGCAATAATATTTAAAGATTAAAAATAAGATGTAAAAATAATGGAGGTTAGTTTGATAGGAGCAAGGATCCATGAAGAAATGCAAAACAAAGATAAAGTCATTATCTTTTAAATAAAAAACTAAACAAATCCTATTTTAATTAAAGTAAGTGATTCTGATGAATATAAATAATTACTCGCGTTAGCTTAAATAATAACAGAAAACTGAAAATTTTGATTATATTCTTATTGAAGCACTGCATATTTTTTATATAACATAAATAAAATACATCAGAAAATACGCTGTATTAAAATTAGTTAGTTAATTGTTGTTTGTTAATCATCAAAAAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-179.9 L-2140.6 L-3123.9 S-0419.7 S-3222.1
S-6164.9 S-9160.7 S-12122.5 S-1596.5 S-24173.9
C-0299.5 C-21,171.2 C-4847.2 C-61,087.1 C-8810.2
C-10413.4 C-12278.6 C-14182.3 C-16246.3 C-18225.3