Summary
Transcript IDgene_000007436
Gene IDTTHERM_00865050
Length2684 bp
Sequence
AAAAAATTATCTTCAAAATGAACACAAGAAATACATAAAGGTCAATAGATCCAAAAAAAGGAAAGTAGCAATAAAAATCAGTTAGCAAAAGTAGAAGCAAAAGCAATAATATAACTTAAAGCAATGAAAAGATAAAAAGGAGTTAAAGATTAAAGTCAAAAGATGAGATGATAGATTCGGTTTAAGAACCCAATATTTTCGTCTAGAAAGATAAAAATAAACAATAATAATCTAAAAGTAAATCTAAGAATTCAACAAAAGAATCAGAAAAAAAGCCTTAAAAAAGAGCATTTAAAATTGAGATACCTAAATAAAATGAATAAAAATTAAAAAAAACTTAAGAATCAAATAAAACAATAATAAATTTGACTAAATAGTAGAAATAACAATTAAAATCATAATAGCTAACAAAAGCTGTAATTGAGTAATAAATACACACTGAATCAAAGAAAAGGGAATACAATAAGCAAAAGAATAAAAATGATAATTTAGAAAAAACTAAAAATAATCATAATATTGTTACTATTGATTCCAGCAATGATGAAAATGAAAGTGAATATGAAATTTCAGATTGTCATATTTCAGTTTCTGTATATAATAATGATAATGAAATAGATATAGATAAAAATGAATAGTCTGTAGATGTAAAGTAAAATAAAAATAAAAATATGATAGATAGTAGAGGAAGAAGTAAAAATAGCCTTAAAATTAAAAAAACATATTCTTCTAGCTAGTAAAAGAGTTAAGAAAAATAGTAAGTTAAAGAATCAACTGCCAGCAAAAGGATTACTCGTAGCCAATAAAATTTTGAACTTACAGAGTTATAAGATACAAAGGCAAAAAGTGCTTCAAAAAACAAAACAATAAATTCGGAAAAGCAAAATTAAAAAATGAATTCTAAAGAAAAAATTGATACAAGCAAAGACAAGAATCCATCATTAATTGAAAGTGAAAAACCTAAAAGAGGAAGAAAGCCTAAATAAGTAGAGATATTAAATGATAAAATTTAAGAAAAAGAGACAGATTAGTAAAAAACACCTAAAAAGAGGGGGAGAAAAAGTAAATAAGAAGCATTGTTAGATAGAAGAAACATTAAGGAGATATAATAATAAAAAGAGTACGAAGAGAAATAATAAAAGAAATCTTCATCTAAAGAATCTTAAAAATTAACTCAAGCCAGCGAACATTTTAACTTTTAAGCGCTAATTTATTAATAAAAACCCGCCAAAAAAGAGTTACGTATTGAAGACAAGAATTATTAAAAAATAAATGTTAAACCAAAACATAATATTTATGATTAAGCTATAGAAATGCTATAAGAATATTCATTGCCAGAAGAAATTCCTTGTAGAGAAGATGAAAAGAAATAAATTTTAGAATTTATAAATGAAGGTTTAGGCAATAATGGTAGCTCTAATTGCTTGTATATTTCAGGTGTTCCTGGTATAGGAAAGACAGCAAGTTTTTTGGAAGTGATTAAAAAATTATAAAATGAAAAAAAAGATGAATTTACTTTCATTCACATTAATGCTATGAATTTAAGTAACCCAGAAAATTTATACTATATACTCGTTAAAACAATAACTGGGAAAAATTGCACATCAAAATAAAAAGCCTGTTAAATTTTAAATGAGCTTTTCACTCGTGGAAAACTTTCAAAAACATACTAAAGCTATGGAGAAAATATTGATAATAAAAATAAGGTGATTCTCTTAGATGAATTAGATTATTTAGTCACATAAGATTAGGATTTACTTTATAACTTAATGGAATGGCCTCATCATAAATACTCAAAATTAACTATTATTGGGATAGCTAATACTATGAATTTACCAGAAATTTTGATGAACAAAATTAAAAGTAGAATGGGAAGTAGAAGACTTGTTTTTAATTAGTATAATCATAAATAAATACAGGAAATTATTGCTACTAGACTTAAAAATTAGGAAAAAGTTAGGGAAGTGTTTGAGTAAAATGCAATAGAATATACATGCAGAAAAATTGCTATTTCATCTTCAGATATAAGAAAAACATTGAAAGTGTTAAGAAAAGCTGTTGAAATATGTCAGTTAGAAAACTTTTAAAATTAAAATGTTACAAAAGTAACTATTCCTATGATTTAAAAATCGTATAGCTAGTTATACTCTTCTCCTATTCTATATTCAATTTAAAAACTTTAATTTCATCATAAGTTGATGATTCTTTCTATAGCTTTAGAAAATAAGCACAGAGGAATACCAGTAGCTTACTTGTCAGAGAGCTATAATAGATATAGAATAATGTTGAGCAATCTAGGTAAAAACGAAACTATTAATTATAATCAAATGAAAATGGTCCTGAACTAACTTTCTGTTTTAAATTTAATACAATTGAAGGAAAAAGAAATAGTTAAAGATACACAATTAATTGGTTTAGATCCTAATAAGAAACACTTTTGTCATGTTGTTGACATTTAAATTAATTCTAATTTTAGTGTTGATGATGTCACTAACTCTCTAAAAGAAGATGAAATTTATTTGAAATTCTAACATTAATTCTGAACAGTCGGAATCTGTTTTAAAATAACCTCTCTTTTTTTTTAATTAATTGATTAAATTACTGCTAATCTAGAACATTATATCTTATAATTAATAATACTACTTTGTACATATCTAAATTTTATGCTTTCGTATTTTATACCAGCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1373.7 L-2233.0 L-3243.9 S-046.1 S-349.8
S-638.8 S-937.9 S-1242.2 S-1540.3 S-2458.5
C-032.9 C-2294.0 C-43,158.1 C-63,652.5 C-8972.1
C-10303.2 C-12274.1 C-14760.9 C-16428.4 C-18119.6