Summary
Transcript IDgene_000007444
Gene IDTTHERM_00930650
Length1691 bp
Sequence
AGTGATGAGCACTTAGATGGAATTAATATCAAAACTTTTGTAAAGAAAAGAATAGATGTGCTTATTACAGAATAGACTTTGTTAAATGGTCCTATTTCTAGTGATTTTCCTTCAACTACTCCTCTTTATCTAACAAATAAAAAAAGCAACAACTCCCTAAAAGATACTCTGAAATAGGCTATTCAAAAGACTGTAGAACAATTTGCAAGCCTTGTAATCGTATCATATCCAAACGAAAGAGTGATTGAAATTATTATGATTTTGTGGTAGATATGGAATGAATCTAAAAAAATTTTTAAAATCCCTCAATAAGAAGACTAGTATGCTAAAATAGAGTTCTACCATAATTATAAAAAGTATTTATAAGATTTAGTTAATGACTAAATTAAATGCATGAAGAAGGAAACAGCAGATATATTGATAAACAGCAATCCCTTATAACCAGAAAGCAATTTTATCAATTTGGAAAACATTTTTACTCCTTAATAGCCAGGCTAGCCTTTTAGGGGACCTAAAATTATTGTTACTACACAGTGTTGTCTTTATTATCCTTAGATGCTTAATTACATCAAAAGTATGGCAAGTAGTGATAAAAACACACTTTTATTTATAGGAAAAAAGTCAAACTCTAATAGATACAAATGGCTGAAGTAAGGTCTTACTGGTTTGATAAAAGAAGATTAATTATTGCTTAGTGAATTGAGCAAAACTGTGATTAAACAGTTTTTATTTGAAGAAGAAGAGTAAAACTAACCTTAATTGAACTATCAACAATCAGGAATGCCTATTGAAGATAACTTCGATAATGAAACTGTAGCCACAGCCTAGGATAACCATATAGAAGATTTGGATGATAAAACAAATATAGGAAAAGACTTATTTGATAATGAAGAAGAAGAGCAGGAATAGCTATTTGAATATAAGCAAAAGGACTACTACAGATTTTTGTATAAAACAACAAAATATAAAAAAGGAGATTATGGTGAAGAGTTGACAGAAGAAGAATTAGAATTACTAAAAACTATAACTAATAAAAAGAAAAAAAAGGACATGCTTGCAAACAGAACATATATTACACCTGAATAAATAGCAACACAAGTATTTGATCTTGTTGAAAACACACTAATATAAAATTACAAATTAATCCCTTTCATGTTCAATTCTTGTATGAATATCTAAGAATTCAATATCGATAGCGTTTCTGATGATAGATCAATCTCTAATATCTTTACATTGCTTAATCCAAAAAGAATATTCTATATAAATTAAGGAATAAATTAAGTTTAAGAATTATTAAGAGAAGAAACGGATATTCATAATAAGAGTTTGGACATTTTTAACTTTTAGAGCAAGATAAAAATTAACAGCAAAGTGTAAGGTAGACGCTTTGTTGGAAAAATAACTATGAACTATAATGAAGGTAGTTAAAATAAAGTTAATTTAACATTAGAGCAGGAGATGAATAATTCAAATCCTAATAGGGAATACTATGGAGATTATCCTCTAGAAAAGCTGTTGGAATACTTACAAAAATCTGGCTATACTTTTACTGTAGCTTGGGGTGGTATTAATTATGAGGATAAAGTTATTATTAAAAAAGAAGACTAGAACTTCAGCGTGGAAGGTATAAGATGCAAGGAATACTATGAAATAAGGAAATTAGTATATGATTTTTTATAGAGCTTTTGAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1552.6 L-2505.6 L-3497.6 S-0277.5 S-3302.5
S-6244.0 S-9212.1 S-12232.1 S-15302.3 S-24365.9
C-0435.2 C-2376.0 C-4387.7 C-6808.8 C-8356.8
C-10527.0 C-12359.2 C-14374.6 C-16420.4 C-18376.8