Summary
Transcript IDgene_000007492
Gene IDTTHERM_00919680TTHERM_00919690
Length5851 bp
Sequence
GCGCTTTCTGATTATTTTATTCAGATTAATTAAATCTTTAAATCAGAAGAAAGAAGATAAGAAGCAAAGTAAAAATAGATTTAACAAGAATATTAATAAATAAATCTAGATTATACTAACTTAGACAAAAATAAGTGATGGAAACAATAGCTGAAGTTTTCAATGAAGTTTAGGAGTCTACCTCAGTCTCTTAAAAGCAAGTATATGCACTTCTTGAGTAGTATGAAACAAATAAAGCAGTATTTCTTAAAGCAACAGAGCAATGCTATCTTAAAATTATCAAGAGCTTGCTTAAGGCACCAAGAAAATTAATTGAGAAATATGAAAAATTGACTGAAAAATTATTTGAAACAGGATATCGTTAGTACGCTCTCAAAGAAGATTAGTCATCAAAAAAATAAAAGTTAACAAAAAGGGATATCTTTTAACTTTTTTAACATTTCTTGGCATTTTTTGCTGGAGCTCTTGACTCCACTTAACTCTAAATAAGAATCTTCTCTTCTCGTATAATTTTCTAACTCTTAAAGATATTACCTTCAGACACTCTTGTAGATATTATTGAAGTAAAAGTTGCTAAGTAATTAATATTAGGTACTCTTTCTTTGATGAAAGAGAAGAAGGGTAACTTAAAGCACATAGGTATTAAGATTACGTCTTATTTGCAAAAATTAATGGATAGAGATGATCTTACAGAAACATAAGAAGCAAAAATTCTTAGAAGCGAAATGATGAAGAGTATGTGCATGGACGACTAAGACTAGATTAGAAAATTGGCATTAATCAACTTGGAAATGAATGAAAGCACCTTCCCCCATTTAATTAAGAGAATCAGAGATAAAAATCCTGAAATTAGAGCTACAGTCTTCAAGAAACTTATTAAAGAATAAATACCTCTTGCTAACTTAAATTTATCTGATATTTATAAACTTATTTATGATGGTTTAGGATCTAGAGAATCATCTGTCCGTGAAGCATGTATAAGATATCTTTAGCTCAACTATAATTTGTTTAAGGAAGATGAAGAAAATCCTTAAAAAAATTAAATTGAAGAAGAAATGGAATTAGAAGAGAACAAAGAAAAAGATGGAGAAAAAGAAGAAAGCTCTGAAGATAATGAAATTGATGAAGAAAAAACTAAAAAAAAGCAAAGTAAATCTGCAATTAAGAGATTTTTCACACCAAATAAAGAGACTGCCATGAAAGATTTGAAAATTAAAATTTTAAACTTTTTAAAAACCTTTGAAATTGAAAAGAGTCTTTACTACCCTGAATTATACGAGAGTTTAGAATTATTAGTAAAGGAAACTATCAAATAAATATTAGATGCTGATAGCTTCTCAGCATACTTAAAGGATTGCTTTTTAAATCAACTTAGTCTTAAAAAGAAGAAAAAGCACACTTAAATTTCAATCGAAGGAGAAGAGCTATTCCTAATTAGAGTCCTCTGTTAAATGGTTTAAAATCAAGATGATAGAAAGGAACTCAGTCCTGAATTAGTAGCTGTAGTGGAAGATTGCTTCCCAAACGGTGTTGATTTCTCTTAAGTGATTGACTACTATTCATTCACTTAGCCTAATTTATTTTCCCTCTATTAGGTTCTCCTTTTGGCAGAACTTCTCATTAATTGTGATGAATCAGGAAGAAATAAAATTGAAGAAACTCTAAAAAATTTAGTTATTAACATGAGTAATACCAATTTAATATCCGAAATCCCAACTGATCCTTCTAATGAATACAATGATATTTTCTATTACCTTGAACCAGATACTGTTATGAATAATATTTTTTCTCAATCATATTTCTTCTCTCCTATCATTACATGCTCGTATGAATTACTTCCAATTATAGTTCGTATTTTAAAGAAGATTGTGAGTGATGGTAGAGTGAATGTTCAACTTATCTAGCTTATTTCTGAAGTTCATGAGCCTCTAGCTAAAGACACAGATAATGACTCACATTTTGATTTACCTTCAGAATTGGAAAGAATAAGAAATAGTATTAATGAAGAGAAAAAGAAACTCGATAATATTGAAAAAGAATTGTCGAATCTCAAAAAAAATAAGACAAAATAAAACGAAATTTATCAATTAGAGAAGGAAAAAGATGAAAAATAAGCACATCTTAAAATTTGGGAAGAAAAGGAAGATGCTATTTAGTCAAAAATTTTTGATATTTCTATGAGAGAGCTTGTATTAGTTTAATCTCTACTCACTTATTGCAAAGTTGATCCTAAAGATCCTGCTATTTCAAATTTATTGTAGCAAATCATTTTACCTGGATTACATTCTTCTGATAGAAGTTTAAACTTCAATTCCTTGAAATCACTTGCTCTCTATGTTTTGATTGATAAAAAGAATTGCATTGATTTCTTCTCTGTATTCAGCGATATTTTGGACAAGAGTGAAAACTGCTAGAATTGTACTCCACAAGAAATCATTTCATTGAGAAGCATAGTAGATTTCCTACTTCTATATGATCTCACTTAAAAGCAATCCCAAGATGACGAAGATATTGACATTCCTCAAACATAAGATTTAATACTTAAGTATGCTTATTAAGCTGATATTCTTCTTAGAACTATTTCAATTGAAGGGTTAAGCAAATTGCTATTTAACGGAAAACTTCAAGACCCACACACTACTATTTGCTTACTTTTGGTTATTTGGTTTGATACTAAAATCTGCACAAAATAAGGCTTTAAGGCTATTCAGATACTTTCAACTTTATTTAAGACTTTCACTGCCTCGAACTATTACAATCTTCAAATATTTGAAAAAGCTTTGGAATTATTCTCGTAGTTGATGGTTACACTTGAGAAGAAAGGATTAGTTTTTAATGATGAATATGTTATTTTTGATCATAGCAATGAAAAGTTTATTTCAAAGGCTCTTAGAGTTGGAATTAACTTAATGTCCTATGAATATCATAATAACACTGAAGTGCTTAAAAACGTTTCTTCTAATGAATTTCTTCCATAAGAAAGATTCTTCCTTTTCTTGGCATACAAATGCTCAAAAGAAAGACGCTTCCAATCTCTTTTTGAAAAAATTACTTAGTACTTTGACTTTTACAATAAGTGCACTACTGAGTAACTATAAATAATTCTTCACTTCTTAAAAGAAGCTATCGAAAATTGCCCAGTTAGTAAACAGTTCAATTAATTGGAAAAAGTAATTAAAGACAAAATAAAGATTCAAGATAAAAATGAAAGATAAGAAGAAGATGAAGAAAAAGAAGAATTAAATAAAGTTTTAGGTAAAGAAAAGAGTGATAAAGAAGAAGCAAATGATGCAGAAAATGGTGAAAATGGCTTAAAGAATGATGAAGATTAAAAGCTTTATACTTTAAATGCAAAACAATTAAAGATTTGTGATAAAATTATTGAACTATTTGAAGGTAACCAACAAGATATTGAAGTTATTGTCAAAAATCTCTTTTCAAATGGAACGTTGATTAATGACTCTGCTGAGCAAAAGAAGAAAAGAGCTATGATGTATGATGAAGAAGATGAAGAAAGAGCAAATAATGAAGAAGATGATGATAATGAAAAAGAAGAAAAGCCTAAACGTGGTAGACCTGCTAAAAGAAAATCTATCCACCCTAACTCAGACGATGAGGAAGAAGGAGAAGATGATGATGAATAGGAAGAAGGTGCCTAAGAAGAAACAAAAAGAAGAGGCAGACCTAAAAAAGATATCTCTGAAGCTTCTCATGCTCCATCATAGAGAGGTAGAAAGAAAAAAGCTATCTATATTGATTAGGAAGAAGAAGAAGATAATGAAGAGGAAGAAGAATAAGAAAATAAAGATTCTAAGAAAAACTCTGCAACTAGGAAAGCAAAGAATGCTAAAGAATTAGAAGATATACTCAATTAAGAGACAGAAGAAGATGAAGATGATGAAGATAGAGAAGAAGTAATAAATAAAAGAACATCATCTAGAAGAGCTTAAAAAACAGTTTTACCAGAATCTAATGTTGCTCAAAAGACTAGCAAAAGAGGAAGAAAGAAAAAAGATGTGTAAGATGAAGTTATTGAATAAGATGAAGAAGACGATGAATAAGAAGAAGAAGACATGTCAGCAGAATAAGACATTGAAGAAGAAGATAAAAAGAATAAAAAATAAGTTGGAAGAAGAGGTAGAAAACCAGCTTCTACTAAATCTATGGGTTCATCAAGTGAAAAAGAGAGTCCAAAAACTAACAGGAGAGGTAGAAGATCAGCATCAAAAGAGAATAAAATATCTGAAGAAAGTGATGAGGAACATAAAGAAACAGACAACGAAGATTAAGAAGAGGAATTGTCTTAAAAGAAAACAAGAGGCAGGGGCCGTCCTAAAAAATCAAATGAAAAGACTTAATCATAGGAAGAAGAAGAAGGATAGGATAATTCATAATCTGATGAATAAGAAGAAGAGGTGGAGGAAGAAGAAGCCCCTAGAAAAACAAGAGGAAGCTCAAAAAAAAGTACACCAGCTTAAAAAAAATCAAAAACAAGATCTTCTTAGAAATCCGTTGATAATGAAGAGAGTGGTGAAGATGAGGAGCAAGAGGAGTAAAAACCTTAAAAGAAAGGAAGAGGAAGACCTAAAGCTTAACCTAAAGAACCTGAATCAGAATAAGATGAGCAAAACGAAAGTGAGCAAGAATAAGAAAATGAAAGTGAATAAGAGGAAGAAGAGGACGATAAGCAGACAAAAAGAAGGGGAAGAAAACCAAAAAATGTTACTCAAGCAGTGAAAAGAACAACTAGACACAATAGTGCTAATAAAAATTCTGATAAAGAAGAGTCTGAAGGAGAAGAAGAAAATGAAGAAGAAGAGTAAGAGGAAGATGAAGAAGAGTAAACTAGGGTTACTCGTAAGAGGGGTAGAAAACAAGCTGATACAAAGAAGCCTACCAAGAATGAATCTGTAAGAAGCACAAGAAGAGGAGGTTCTAGAAATAAAATGGAGGAAGAACATGAAGATGAGGAAGAGAACGAGTCTTCTGAACAAGAGCATGAAGAGTAAGAAGAAGAGGAGGAAGAGTAAGAGTAGACTAAGACTAGAGGAAGACCTAAAAAATCACCAGCAAACAAAAGTCAAGCAAAAGAAACTAGGGGAAGAGGTAGAAAAAAAAATGAAAAATAATAGAGTGACTCATAAAGTGAAGATGAAGGAGAAGAGGAAGAAGATGAAGAAGATCAATAAGCAAACTAAAGAACAACTAGAAGATAAAAATAATAAATAGAAACCTCGAAAAAACCAGTGAGCTCCTCCTAAAGACTTAGAAGAAGAAAATGATTAATTTTAAAAATAAGAAAATTTGAATTAATAAATTGATTTAATAATAAAAGTACATTTTATATAAATATCTATGTAGTGAGTGTTTTGAGTTTAAATGAGAATTATCTATTTTTACTTTATCAAATATTATTTATTTATTAATTAATTATCATTTTAGCTTGTATATCGTGTAAAGTATATGAGAAATCAAAATTATCCCTACTGAGCTAGCTAAAGGTACATTCTCAAACACAGAAAGTATAGAGAACACTATTAATAAAGTTAAAGTCAATTGATTTATTTTCGTAAAAGCTTAAATTGAAGTAATCAGTTTTTCTTTTTTAAACATCAATTTCTGAAGTTATAATCTTAAAGTGTTGTATTTAAATTTAACAATATTTTTGTAGTTTTCTTTCATAGCTTATAATTCTATTAAGATTTTATTACATTGATTTATTAAATCTTCTTCTTTAGAATCATTATCGTTTTCTAGGCCATCTTTAAAGGCAATAACGAAATCTTCATATTTATCATAAATAAAATTTATACTTTATTTATCTTATATTTTTTTATCATTAGCTTGGAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,188.8 L-22,202.2 L-31,863.6 S-0597.0 S-3701.1
S-6275.1 S-9304.0 S-12403.6 S-15427.9 S-24728.0
C-0518.8 C-25,951.7 C-411,724.5 C-617,811.5 C-812,543.3
C-107,014.6 C-123,297.2 C-143,047.6 C-163,511.2 C-182,770.8