Summary
Transcript IDgene_000007494
Gene IDTTHERM_00920750
Length748 bp
Sequence
TCGCATTTTAATATTAGATTTTCTATAATAAATAGTCACTGAAAGTTCTTCAATCTGCTTATTTTAGGTTATTTTAATTAGCAAATTACATCATGAATAGTGCTTAAGATAGTTAGAGTACATTTTAGCAGTTCTAAGCGATGTATGGTTTACCTCAGAATTATCCTAATAACACCTAATAGTTTTAGCAATAGGGTTTAGGAAACATGGCTTCGAATGTTAATAAGCAGCAATTGCAAGTTATTCAAAGCATTTCAGAAGCTCCTGAAAAAGATGAATCAAGTGCATTGAATTTTGATGAAGATTTAATTTATTCCTAGAGGCTCAATTCTTAAATTTTAGAATAATCATTGAATTAAAAATAGTAGATTCTCTAAAGTTAAGGATAACCATTTAACAGCATATATTCTTAAATAAATATGGATTTATTATAATAGAATACCAACGGTAGTTAAAAGTAGAAGCTAAAGACAGTCTAACAAAACTAACAAGTTAGGAATTAGTATTATACAGAATAAGTAGATCACGTAAATAATAAAAAGAGCAATAATGCATCAAATGTAACAAACTAATCAGGTTTGAAATAAACTTTACAAACTAACTCTGATGAAATTTAAAGGCTTATTAAAGAAAGCTCCTAAAGAATAGTTTAAACTGAATAGCTTGTCACTGCAATAGATGAAAGATTTTCAGAGGGTTCATCACTTCCCTAAAGGCAAGCAGATATACCTTTTGAGATCAAAGATTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-186.9 L-285.5 L-356.9 S-037.5 S-352.1
S-635.7 S-939.5 S-1230.5 S-1530.9 S-2461.9
C-032.5 C-250.4 C-458.1 C-679.9 C-856.7
C-10117.8 C-1288.8 C-1462.1 C-1655.6 C-1846.2