Summary
Transcript IDgene_000007573
Gene IDTTHERM_01005160
Length1460 bp
Sequence
AAAAAATTTAATTAACACAACAATAAATATAAGATAATGTCTAAATTATTAGCTTTAGCTTTAATACTCTCACTTTTAGGTACTGCTTTAGCTCTTTATGACAATAACTCTAAAGTCATTAAGCTCAACAAAAGCAGATTTTAAAACGAAGTCATTAACTCAAAAGAACTTTGGCTTGTTGAATTCTTTGCCCCTTGGTGTGGTCACTGTAAGAGCTTGGCTCCTGAATGGGAAAAGGCTGCTAAGGCCCTTGAAGGTATCGTAAAAGTCGGTGCTGTTGATATGACTACTGATCAAGAAGTTGGAAGCCCTTACAACATTTAAGGTTTCCCCACTATCAAGTTCTTTGGTGATAATAAGTCTAAGCCCTAAGATTACAACAGTGGAAGAACAGCAAATGATTTAATTAACTACGCCTTAAATGAAGCTAAGAGTATTGCTCAACGTCGTTTGAGTGGTGGAAGCAGCTCATCTGGAAACAGATAATCAGGAGGCTCTAAGGGTAATGCTAATGCTGATAATGATGGTGATGTTGTTGTTTTAACCGATGATAACTTTGATGCCAATGTAGTTGGAAGCAAAGAACCTTGGTTCATTGAATTTTATGCCCCTTGGTGTGGTCACTGCAAGAATTTATAACCTGAATGGAATAAGTTAGCTACTGAAATGAAGACTGAAGGTGTTAAGGTTGCTAAGGTTGATGCTACAGTACATCCTAAAGTTGCTCAACGTTTTGGAGTTAATGGTTATCCCACCATTAAATTCTTCCCTGCCGGTTTCTCCAGTGACTCTGAAGCTGTTGATTACAATGGTGGCAGAGATGCTTCTTCATTGGGAAGCTGGGCTAAGGAGCAAAGAGATGCTAAAAAACCTATTATGTTCACTCAACTTCTCAATCAATCTATTTATGATGAATACTGCACTAACAACTCTGGTGTTTGCATTATCTTCCTTCTTCCTCATATTTATGATTCTTCTGCAGCTCAAAGAAATGGATACATCAATTTAATTACTGAAATCGCCCAAGCTAATAAGGGAAGACCTATTACTTACTTATGGAGTTAAGGTGGTGATTAATACGATTTCGAAGAAAAGCTTAATGCTGGAGGCAGTGGTTATCCTTCTGCTATGGCAATTTCTCATAAGAAAAATCTCTACCAAATCTTTAAAGGTTCTTTCAAGAAGAAAGACTTAGATAGCTTCATTTCTGGATTACTAACTGGTCGTGGTAGCTTCTCTACTTTACCTACTCTTCCTAAAATCAAAAAGGTTAAGGAATGGGATGGTTAAGATGCTGAATAATAACAAACTGATAACAGCGATCTTTGAGTTACTGTATTTTAAATTTAGTTAAAATTATTGTCTAGAATATTATTTTGTTAGTTAGTTAGTTAAATATGCATGTAATAAAATAAATGTATGCAGCCTAATTAAATAATCATTTTATCACTCATAATAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-127,172.3 L-227,529.5 L-324,547.8 S-018,518.9 S-312,065.4
S-616,318.0 S-917,081.3 S-1216,969.0 S-1521,256.3 S-2415,861.0
C-09,801.1 C-25,169.7 C-415,639.6 C-610,286.1 C-810,241.8
C-1016,329.9 C-1222,752.6 C-1417,718.6 C-1617,576.3 C-1816,074.5