Summary
Transcript IDgene_000007596
Gene IDTTHERM_01049200
Length1724 bp
Sequence
TAAAAAAATTAATAAAAAAATCAATAAAAACTAAAAGATAAAAAAGAAAGAAAAAATCTAAAAGAAAAGATTTCATTTAAAAAAGATGCTTTCCAAGATTTTAAGTTCCAGATTACCTGCTAACTCCTTAGTTAGTATGTACAACCCTTCCTTCAGCTCTGTTGCTGGTGAACCCAAGTTCTTAGAAATGGTCCACCAATACTTCGATGCTGCTGCCTCATACACCAGAATCTCTCCTGATAAACTTAACTACTACAAGAAGGCCGACTGTGTTATCAAGTTTACCATTCCCCTCGTTAGAGATGATGGTACTATTGAATCCATTGAAGCCTACAGAGCTTAACACAAGTTACACAGACTTCCTACTAAGGGTGGTACCAGATATGCTAAAGACATCAACATTCAAGAAGTTGAAGCCTTGTCCTGTTTGATGACTTTAAAGTGTGCTGTCGTTAACTTGCCTTACGGTGGTGCTAAGGGTGGTATTGGTTTCAACCCCAAGTAATACTCTGCTAGAGAAATCGAATCTCTCACCAGAAGATACACTCTTGAATTAGCTAAGAAGGGCTTCATCGGTGCTGCCATCGACGTTCCCGGACCTGATTTGGGTACTGGTGAAAGAGAAATGTCTTGGATGAAGGATACTTATCAAACTTTCTTCGGTCACAAGGATATCAATGCTCACGGTTGTGTCACTGGTAAGGCTCTTAACTAGGGTGGTATCAGAGGTAGAACTGAATCTACTGGTCTTGGTGTCTTCTATTGCACTAGAGATCTCCTTAACGACAAGCCTCTCATGGAAAAGTTCGGTGTTGAACCTGGCATGAAGGGCAAACGTTTCATCATCTAAGGTTTCGGTAATGTCGGTTACTGGGCTGCTAAGTTCATCACTGAATATGGTGGTATCGTTACTGGTATTGCTGAATGGGATGGTTCCATCTACAACTCTAAAGGTATTGATATTGAAGATCTCTACCAATATAAGTTGAACAAGAAGGGTATCAAGGGTTATCCTAGAGCTGAAGAAGCTTTCGATAACGAAGATGCCATCTACAAGGAATGTGATGTCTTCATTCCCGCTGCTTTTGAATAAACTGTTAACAAGAATAACGCTAACAGATTCAACTGTAAGGTCATTTCCGAAGCTGCTAATGGTCCTACTACCATCGCTGCTGAAGAAATCTTAACCAAGAAGGGTGTCGTTTTCTTCCCTGATATTTTAGTTAATGCTGGTGGTGTTACTGTATCTTACTTCGAATGGCTTAAGAACTTAGATCACATGAGACCTGGTAGACTTACTAGAAAGTGGGAAGAAAAGTCCAAGCTCAATCTCCTCCACGTCATTTCAGACATCACTGGTCTTAAGTTACACTAACTCGAAGAAAAGCACAAGAATCTCCTCAGAGGTGCCACTGATAAAGATATTGTCTACTCTGGTTTGGAAGAAGTTATGTCTGTTGCTGTCAAGGAAACCAAGGAAACTTGTCTCGAATTACACTGCTCTATGAGAATTGCTGTCTACGTTAATGCTATTAGAAAGATCCACTAACATTTCGAAGTTGCTGGTATGCCTCTTGCTAAGTGATCTAAATTTTAAAAAATCTATTAACATATTATACACTTCTAACTTAAAAATTTAATAAATGTAACTATCCATCAAATTTATATTTTTTGTGTAAACATAAGCTGTTAGTTCGTTTATTCAAACCACAATATCCCTTAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-155,079.9 L-254,539.9 L-355,766.8 S-041,883.4 S-316,587.3
S-618,923.2 S-932,383.4 S-1228,535.6 S-1535,052.6 S-2430,515.4
C-08,271.1 C-219,047.5 C-419,985.3 C-68,974.6 C-840,626.8
C-1055,266.1 C-1255,886.9 C-1451,192.9 C-1643,470.5 C-1828,611.7