Summary
Transcript IDgene_000007862
Gene IDTTHERM_01093500
Length667 bp
Sequence
ATTTAATAATATTTTTGTCAAAACAAAAGTAAGCGCTTTGAATAACTTAAGATATAAAGAAAATAATTATGGAAGGAGAAGGATTAAATGCCAAGGCTCTTAATGATGCTCTTATGAAAGAAGACGAGTGGGCCAAGGCTATCATTTTTGATCAAAATTTAAATATAATTACTCATAAAAACTGCCCTGCTTCAGTTGAAGAATTGAGACCTTATTTAACTGCATTTGACTCTCGTGATAATACCATCGGAGCAGGATTTGAATTATTAGGTGAACACTATGACGTTCATAGATTCCACCCTCCTCTTGTTTATGGCAGAAGAGGTGATGCTGATGTTGGTGAAGGTATCTCTCTTGCTAAAGGTTTCTCTAAGAAGGCAAACTCTAATATTTACTTGCTCATCACTTACGAATTACCAATCATCTCTGCTAGAGCTGTTCCCTAACAAATCAACTTCTTCAACAATCACATTGGAGAACTCGAACAAGCATAATGAAGCAAATTAATATATATGTATGTACTTGTTTATAAACTTAGATACTTTTTTAAACTTAGAGTAATTTTTAATCTAGGATTTCAATGAATGTTGTTGTTACTTAAGATTATTCTGTTTGTTTTTATCAACGATATATATTTGTGAATGATTTTTTTAAATTTAAATAAATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-114,471.9 L-213,740.0 L-312,905.1 S-010,401.3 S-36,123.8
S-68,890.1 S-98,248.3 S-128,111.3 S-158,804.9 S-247,429.3
C-06,406.7 C-24,607.1 C-45,649.0 C-68,076.9 C-86,039.1
C-106,275.1 C-126,635.3 C-147,981.8 C-166,717.0 C-187,171.0