Summary
Transcript IDgene_000007911
Gene IDTTHERM_00803600
Length720 bp
Sequence
GAAAATGATTGCTAAAGCTTTATAAAAAGTGTTGGGAAATTCAAGTATGAAATTAATACATAGCAGAAATATAGTTTTAAAATAAAGGTGCTTCCACAGTTCTGTGGATTCATCAGAAATGAATCATTTTTCTCAGATTAAAGATTGGTGGAAAAGTGGGAGTGAAATGGCTCCTTTGTATTCATATAACTTCGCAAGAGTTAATTTTATTAAAGAATTTATGAAAGATTTTAACAATTAGAACTATCATCTGAAGCTTCCTTTAAAAAATCTGCAGATTTTAGACGTAGGATGTGGTGGAGGACTTCTTTCAGAAAGCTTATGTAGACTTGGAGCAAATGTAACAGGTTTGGATGCAAATGAGAATTCTATTTCGATTGCAAATAATCATAAAAAGCTTGATTAATTTTTAGAGTAAAAATTGAATTATAAATTAGGAACTGCTGAGGAATTAAGCTCTCAAAATATTTAGTACGATTTGGTAACATGCATGGAAGTTATTGAGCATATTTAGGACAAAGAGTAATTTATTGCTACATTAAGCCAGTTAGTTAGACCTGGTGGAATGATTTTCTTATCAACAATGGAAAAGACTAGAGAATCTTACTTAAAACTTATATTAGGCGCTGAGTATATTGCAAAATTAGTTCCAAAAGGCACACATGATTGGAATAAATTTATCAATTCTGAAGACTTGTCAGCTCTTTTAGAAGATAATGG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,336.8 L-21,046.4 L-31,064.2 S-0365.8 S-366.3
S-673.4 S-951.5 S-1270.5 S-1579.3 S-2497.0
C-068.7 C-260.0 C-446.5 C-633.7 C-8111.2
C-10158.5 C-12197.2 C-14151.4 C-1689.2 C-1862.0