Summary
Transcript IDgene_000008004
Gene IDTTHERM_00313119
Length2258 bp
Sequence
ATAATATCATATTTAAGTAATGTCGAGACACGAAAATCTATTAAGGATTAAAGAAATTAATCTTTAAGAAGAAGGTAATATTAAAGAAGCAAAGCAATTGTTGCTAAAGAATGTTACAAAATCTTAGCTTCCTGATTTCTTCTACGAGCATATAGCAGGTATTATAGTAGAAGAATGCCCTACTAATGGATAAGAATTATATGAATTGATTGGTGAGTTCATTTAGAATGGCAATTAAGTTAGCAAAGAATAAACATAAAAGATTTGCGTCGAATTACAAAAATAATTATTAGATCAAAAGATTATCAAAATAGAAGACAAATTTAATTTAGTTGCTGAAAAGTTAGATGCTCCAATTACTTTGAACCAAGTTTAATTGATTAAGGAAATAGATATTGCATCTCATGGCTACGATGATGCATTCAGAGGAACCAAGGGTGCTGCAAATACAAATGATGAAATCAGTCACGAAGAATTAAAAATAAAGCTATAGAAAAAGGAAGAAGAAGCAGTAAAAAAGAAATAATAGCTCTTCGAAAGATTTAAAAACGAAATTAACGAAAAAGAAAGAAATCTACCTCCCGTTTAGGTTAGACATCATAGAAATTCAGAAGCTAAAACACAAGATTTACAATTAGATAACGTTAATGTTATTATTGGTGGTAGAGCTTTGCTTGAAGATGCTAAACTTAGACTTACATATGGTAGAAAGTATGGTTTAATTGGTAGAAACGGTATTGGTAAGACTTGCTTTATGAATGCCTTAGCTAGAAGTGAGTTTGAAAATATGCCCAAGCACTTATAAATTTTATTAGTCGAATAAGAAATGAAACAAAGTCACAAATCTCCTATATAATTAGTTTTGGAAACTGATATTGAAAGAGAATAGTTGCTCTAAGAAGAACAAAACTTAGTCACAAGCAACAACCCAAATACTGCTGCTCGTTTATAAGAAATTTACGAAAGATTAGAATAGATTGATGCCATCACTGCTGAATCAAGAGCTGCTTCCATCTTAGGTGGTCTCGGTTTCTCTTAAGAAATGATGAGAAATCCTACTTAATAATTATCTGGTGGTTGGAGAATGCGTGTCTCTCTTGCTAGAGCTTTGTTCGTTTAACCTGATGTTTTACTACTCGATGAACCCACTAACCATTTAGATTTAGATGCTGTCATGTGGCTTGAAGATTATATTATTAACTGTTCAATTACTGTTGTTGTTGTTTCTCACGCCAGAGAATTCTTAAATGTCGTTTGTACTGATATTATTCATTTCTTTGAATAAAAGCTTGTTTACTATAAGGGTAACTATGATTAATTTGAAAAGACTCGTACTGAAAAGCAAGCTATGGCTAAGAAGAAATTCGAATCCCAATAATCTAAGATTGCTCATATGCAAGAATTCATTGACAGATTCCGTTGCAATGCTAATAGAGCAGCCTTAGTTTAATCTCGTATTAAAGCTATTGGTAAATTAGAACATGTCGAAGAAATTATTGAAGATCCTACTTGCGTCTTCATTTTCCCTACTCCTGAAAAGCTCCGTCCTCCCCTTCTTAAGATCGAAGATGGTTTGTTCGGATATAAAAAGGAATCCACAATTCTCAGAGGTATTAACTTTGCAGTTGATTGTGATTCTCGTATTGCTATCGTTGGTGCAAATGGTGCTGGTAAATCAACTCTCCTTAAACTTTTGGTTGGTTCTCTTGAACTCTCAGAAGGTTAGTAATATAGAAGCAGCAGATTAAGATGCAGTATGTTCACTTAACATCACTTGGATTAACTTGACTTGACTCTTTCTCCTTTAGAATAAATTATGAGAGATTATCCTGGCTCTACTTAGGAAGCATACAGAGCTCATTTAGGTTCTTTCGGTATTTCTGGTAATATGTCACTCAGACCCAACTATTTACTTTCTGGTGGTCAAAAATCAAGAGTTGCTTTCGCTTTAGCAGTTTATAACAACCCTCACATTCTTATTCTCGATGAACCCACAAATCACTTGGATATAGATGCAGTTAATGCTTTAATTATTGCTTTAAATAATTTCTAAGGTGGTGTTTTAATTGTTTCTCACGATCAACATTTAATTTCTACAGTATGCGATCAAATCTGGTATGTTAAACATAGTAGACTAAAACGTTTCAACGGTGACTTCGAAGATTATCGTACTGCACTTGCATCAAATAACTTGTGAAAAAATACATATTTAACTTTTTATGTAGAGTATCAAATTTAAGGACTAAATTAAATTAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-113,167.6 L-211,908.1 L-311,167.6 S-05,314.2 S-35,785.9
S-65,425.6 S-96,948.7 S-128,089.6 S-1510,599.9 S-2412,555.7
C-011,844.8 C-26,126.8 C-428,970.2 C-623,628.6 C-810,082.5
C-105,287.5 C-126,365.2 C-149,750.0 C-169,387.5 C-187,679.5