Summary
Transcript IDgene_000008022
Gene IDTTHERM_00313450
Length1668 bp
Sequence
AAAAATTATTAATTTTCAATAGTATCTATCTCTTTATTTTTATCTAAAATAAGTAGGGCTTATAATATTTACTAATAAAGATTTTCACAACTGAATTATTTACTATCCTACTAATTATAACACCCAAAATGGTTAATGCTAGCACTGAATAGCAAAAAGCTATTGAGAAGATTATCAAGGAAAAAAATCCTTATGCAGATAAAGATCATATTTTATTGAGAAAAGATATCCCGTCATACTATTTTCATCCTCACAAGATTTTTGGATTATTTTTGATTATAATAGCTGCTTATTCTCTTATAACTGGAATTTATTTGGCAAATAATTCTTGTGGCTATCAATACTTAGTACTTTCTATACTTGGAGTAACCCCACTAACATTTTTATTTAACATTCAAATTGGAGAAAAGTTTAGTCTATCTAATTTTTATAAAATCTATCTAACACAAGCGATATGGCTTCTTATAATATCGATAGTATCTTTCGGATTCATCGAAAATGTAGTTGAGCAGTCCTACTGCTCTAACATGTGGTGTCATCCTTAAATAAATACAGCAAGTTTTTTCAATCATTTGAAAGAGAAAGTTACAGTTAGCTAGTTTAATGATATTTGCTCTTAGATACAAAACTATAAATAAATTTATAATAATTATGATCAGAGATTAACTGTAAGTGTTTAATCTGCATTGAAAATGTTTTGCTACAAAGATGGAAATTGTTAACTCACAGAGAGCTTTAACGTAAGTCTTTTGGTAAAATTAAGCAAATCAAGAACTTTAGTATTGGTTTCTTTTTTAGGCATAATGTAGATTTTATTAGCTTTTTATTGGTTTTACTTCTCATACAAGCTTAAATATAATAAGATTACCTTCACACTTTATGAGTTAGAAATGATAATGACTAAAAAAGTAAAAGGCCCTGGATAAAGCCATAAGCAAAAATAACTTAAAAAGGGAGTTAGATAAGACGGCGTTGTTGAAGATTAAGCCTCAAATGCTGGTAATGATGCTTAAAATATGTAATAGAAGATTATTAAAAATGTAGTAAATGATGTAGATTAGCTTTTTAGTATTAACTCAGAAAGTACTGAAAAATAAGAGCAAAAAGATGATAAAATTTAAAAGATGAGAGAAGAAAAAATAAAAGAATTAATGCAACAATAAAAAAATTTAGGAGAAAGTTTAGACTTTGTCATAAATCTTCGTAGAAAATCTCAATAAGATATAGAAAACTAAATCCATAATATAAGTTTTTCACAAAAAGATGAAGATTTTGTAAATAAAGTAGATAGTAAAATTGACGATAACAACAATACCAATTACATGTTTACAGATAATTTAAGCTATTTAAATCAAAACAACATGAGTTTTAATCTAGATACATAGAATGTAATAAGGTAAGATGATGACTATGATAATACTATTTTGCCATTCTAGCCAACTCAAACAAGATTTTATGAAAATCCTGAAATGAATAATACTGTGCATAACTTTTCCTATACTAATGAAGTCAATGACCATGAAATTTCAATGCACGAAATATCTCCTACTTAAAATAATGAATAATAAAAATAATAAACAGATAATAATTGACAATAAAAAATAATAATAATAAATAAATCTTGAATAAAAAATATTAACTAACTAACTAACTATAAAACTCTCTAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1177.9 L-2125.7 L-3249.8 S-0216.8 S-3371.6
S-6314.2 S-9400.7 S-12286.2 S-15242.2 S-24226.5
C-0667.6 C-2193.1 C-496.2 C-647.2 C-895.5
C-10146.0 C-12194.6 C-14198.6 C-16260.6 C-18268.6