Summary
Transcript IDgene_000008095
Gene IDTTHERM_00569290
Length2894 bp
Sequence
GAATTTTAATAGAAATAATTAATTAATTAATAAATAAATAATAAGAACGATACAAATAACATTCAATTAAATTAAGAAAGATAAAGCAGTACATCAAAAAAGTAAAATGTGGGGAAATAGCTACAATAATAATAGTTCTAGTAATGGATACTCAAATAACAAAAGCAACGGATATTCAAGCAGCAATAATAATGGAAACTCCTATGGAACCGGTGGCAAGTGGAATGATAACGGAGTTGGTTAAAATTTGGCTGCAATCGATTGGACAAAAGAAAATCTTACTACATTTTAGAAAGTTTTTTATAAGGAAAGTTAGAAAATAAGAACTGAAGAAGAAATCGAAGAATTTTACCGCCAGAACCACATCTCAGCCAAATCACCTCATGGAAAAGTACCTGACCCTTTTTTAAGCTGGACAGATACTCACTTCCCTTAATATATTATGAATGAAGTTACTCACGCTAAATTTGAAAAACCCTCTCCTATTTAGTCTTTAGGTATTGTTTGATTGAATTTAAACCAACAAACCAACCTACGATGGAACATTTTGAAACATAAATAAATAAATAAAAACCTACACACATAGTTTGTTTAAAATATATTTGCAAAAAATAAACATTTAAACAAGCCAATTTCTACACTTAGCATACAAAATTCAAATCACAAACGAGTGTGTGTAATTTAATTAACAATATATATCAATGCGGGAATCAATCAATCAATGTTAAGAAGAAGCCAAAGGTTATTCCTTAAGAATAAGCATCGCTCAATGTTTCCAAAGAGACCAATGTATTTATTCAATATGAATCTACTTGAATAAAGGTGAATTTATTCTTTCTGAGGGAATTATTGATCGAAGTGCTTATCATCCTCATTCTTAATATTGTTTGTACAGCAGATTATTATCAGGAGGAGAACGAAATGGATCCAAAAAAGATAATCAGAGCTGAATGTAACTCATTCCCTGTAGTCCTTAGTGGTCACGATTTGATTGGTATTGCAGAAACAGGTAGTGGAAAAACTCTTTCCTTCCTTTTACCCTCAATAGTTCATATTAATGCTCAACCAACTGTCAAAAAGGGAGATGGTCCTATCGTCCTCGTTCTTGCTCCTACTAGAGAACTTGCTATGCAAATCGAAAGAGAGTCCGAAAGATTTGGTAAATCCTCTAAGCTTAAATGTGCTTGTATCTATGGTGGTGCTGACAAATACTCCTAAAGAGCACTTCTCCAATAAGGTGTAGATGTAGTTATTGCTACTCCTGGTAGACTTATTGACTTTTTAGAAAGTGAAACTACTACTTTACGTAGAGTTACTTATCTCGTATTAGATGAAGCAGATAGAATGTTAGATATGGGTTTTGAAATTTAAATTAGAAAAATCTTGGGTTAAATTAGACCTGATCGTTAAACATTGATGTTTTCTGCTACCTGGCCTAAGAATGTTTAGAATCTTGCTTAAGATTATTGCAAGAATACTCCCGTTTATGTTCAAATCGGAAAACATGAATTAGCTATTAACGAAAGAATTAAATAAATTGTTTATGTTACAGATCAATCAAAGAAAATCAATCAACTTATCAAGCAATTAGATTGTTTGACTTAGAAAGATAAAGTATTGATTTTCGCTTAAACAAAGAAGGGATGTGAAAGCATGAGTCGTATTTTGAATAAAGAAGGATTTAAGTGTCTTGCTATCCATGGTGACAAAGCCTAAAAAGACAGAGACTATGTTATGAACAAGTTCAAAAGCGGAGAATGCAGAATCCTTATTGCTACAGACGTAGCCAGTAGAGGTTTGGATGTTAAGGATGTCTCCCACGTATTTAATTACGATTTCCCAAAGGTTATGGAAGACTATGTCCATAGAATCGGTAGAACAGGTAGAGCTGGAGCATATGGTTGTGCAGTATCTTTCCTTACTTTTGAAGATGATAAAAAGATATCAAGGGAATATGTCCAAATGCTTCATGACGCTAAGTAAGAAATTCCCATTGATCTTCTTGATCTTGCTAGTATTAATCCCAGATACAGAACTTAATATAAAACTGTTTCCTCTTCATACTATGATATTAAGAAATTTAACAGTGCTGATACTTCAAAGCCTTCAGAAAATCAGAATGTTTCAAATACTGCAAATAGCAGCGACAAGTACACCAGCAGTAGCAGCTACAATTAATATAAAAGCAAAAAAGATGAAGATGACAAGAGAAGTAGAAGTAGAAGTCCATATAAATCTGAAAATAACAACAGATGGGATAAATATAATCGCACAAAAAGCCCAGAATACCGCAGTTCTAATGGATCTTCTCATTATAACAACGTTAACAAGTATTCTTCAAATTCTAATAATAATTCAAGTTCATATTCAAAGAATTAATCCTCCACATCATCATCTTCTTCCTATGGATAGAATAATTAATCATCCAATTTAATGAGTAAACCATCTAGTAAATTCTCTGCTCCTACAAATGGTAGTTACACAAATGGATTTTCTTCAGTCTAATAAAATTCTCAAGTTTAAAATCCATTTATGCCAATCAATCCTTTACCTCAACCTTTTATGTACTAAATTCCTGGATTTAATGGTTTCCCTAATCAAGGTTTCAATAACTTTTACACTGGTATGGTTCCTCCTCCTCCACTCCCTACTGGTGCTCCCTCATAATAATAAAATGGATTTGCTTAAAATACAACAACATCTTCTTGAAAACAAAAAATATAATTTTTTATGATTATTAAAACTAATTTATATATCAGCAATTATTTGAAATAAATAAATAAATAATTTTTATAAATTAAACAAATATTAACTGGATTTTAACATAAATTTCAATTACCTTTTATAAAAATATTCACTTTGTATTTCTTCTTTAAATGGTTAACCACTAAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-110,017.6 L-27,012.2 L-34,976.5 S-05,561.3 S-38,841.6
S-68,164.6 S-98,950.4 S-129,528.2 S-1510,834.3 S-2414,465.5
C-018,758.3 C-235,279.0 C-445,454.0 C-652,149.2 C-857,911.5
C-1058,544.3 C-1251,279.3 C-1429,246.2 C-1625,244.4 C-1823,108.7