Summary
Transcript IDgene_000008100
Gene IDTTHERM_00568030
Length788 bp
Sequence
ATAGTGTTTCTTCTTTGACCATGGTCTTAAAAAGTATTAAATGTTTGAACCTGAAGATATGTACACTGTTGTCTTTGAAGGATGGGCTTTGGATGATTTGATTACTTTCCCCGGTTTTACTCCTACTGGCAGAACCAACAGCTATCAAATTGGTCTCTCTCCTAGATAAAGAACTGTTGTTCCCACTTAAACTTTCTATCAAATGCAAGATTACTACATGTTGTGCGGTTTGAGATTTGAAAGATGGTTCAGATGTGATTTAGTTTATCATGATCAAAGACATACTAAGTTCGATCAAGTTAAAAATCAAAAGAACTACAAAACTTATCCTTGCTATAGAGAATATTATGAAGCTTAATACGCTTGCTAAGATGATATGTTTGATTTCTTGATGGAATTGGCCTATGCTAGAAGAGCTGCCGATAACTTCGAATCCGATTTTGCCAGTCACGAACTCACCACCTTACCTACTTTCTACGATACCCCTAAGGCTGCCGAAAGAAAAACTTACACTTACTGAGTTAATTAACTTATTTTAATAGTTATTGTTATTCACCTGTTCTTGGTCAATTAATTGTTTAATTTTGGTTTGTGAAAGATATTTTTATATTGAAAACCAAATGTAAATATTTACTTACTACAACTTGCAGAGAGGTGTTAATAACAAATAAATAAATAAATTAAATTATTAGTACTCTTAATAGGAAAATTTATGATTTATTGTGTTTTCTTATTTCATTAAAGGGTATTTGTTTGCCGTAAAATTCGATAATAATTTCGTATATTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-143,024.2 L-247,194.0 L-345,256.5 S-044,187.9 S-332,391.1
S-625,644.4 S-923,116.5 S-1219,968.0 S-1521,507.8 S-2417,784.3
C-010,061.3 C-213,592.8 C-49,655.0 C-68,348.1 C-812,513.0
C-1015,719.4 C-1222,686.9 C-1416,773.3 C-1615,469.9 C-1815,412.5