Summary
Transcript IDgene_000008297
Gene IDTTHERM_00120930
Length1562 bp
Sequence
CTTTTATTTGTTAATTAATTTAGTGTTTGAGATTTAGTTAAATTGCGTTCATTTTTATGAGGACATTTGAGTTTAAAAAGAAGCAGTTTGGCAATAACTAAGCAAATAGTCAAGAATAGTAGAAATAATAGTGGCAGGAGATTTAGAAATAAAAGAAATAAAGAAAAGAAGAAGACATTTTAGTTGGAGAGAGAGGTGGTTTCTAGGGTTTTGATTAATGGGACTTTAAAGAATTGCCTATTGTATAGCACAAATAAGAGATTTTATATTGCGTAGAAAACTATTCTTGTGTGGTTGTAATTGCAGAAACAGGCTCAGGAAAAACAACAAAAATTCCTCAGTATTTGGTAGAAGCAGGATATGCTATAAATGGTAAAAAAATTGGGGTCAGTTAACCTAGAAGGATTGCAGCGATCAGTATTGCAAATAGAGTTGCTCAAGAAATGGGTTGTATTATTGGTTAAGAAGTTGGGTATAGTGTGAGATTCGATGATAATTGTGATGAGGAGCTCACTTAAATCAAATACATGACAGATGGTATGCTTATAAATTAAATTCTTAATGATCCCTTATTAAGTGAATACTCAGTGCTAATGATTGATGATATTCATGAAAGAAGTATAAACACTGATATCTTGTTAGGATTGTTAAAAAAAATCAGAAGAAAGAATCCACAGCTGAAATTAGTTATTTCTAGTGCTACTATTGATGCTGAAAGTATTAGCACCTTTTTCTAGGAAAGAGTAACAGATCCTAAAACAAATTAGGTTATTGCTAACCTCACTTCGTAAATTTTGTACATAGAAGGCAGACAATTTCCTGTAGATATTTATTACCTTAAAGAAACTACAAGAAATTATGTTGTGAAAGCCGTATAAGTCACTCTTGAAATCATAAGAGCTCCTGATAAAAAGGGAGATATCTTAATCTTTTTGACTGGTTAAGAAGAAATAGAAGCCTTTATCGAAATCATTTAAAAAAATTTTATTGGGGATGCTGAAAGATAAAATTTGAAAATACTTCCACTTTACTCTGGATTGCCTCTAGAGGACTAAATGGAGGTTTTTAAACCAAGTGAATCATATGTTAGAAAAATTATAGTCTCAACTAACATTGCTGAGTCCAGTATCACTATTAGTGGAGTAGTTTATGTTATAGATACCCTTTTTCACAAAATAAATTATTATGATTTTAAAAGAGGGTTTGAAAACCTTCTTGTTGTACCGATAAGCAAAGCTGCTGCTAAATAAAGAGCTGGAAGAGCTGGCAGAGTATAAAGAGGTGAATGCTATAGATTATGCACAAAAGATTAGTTTGTACAATTATACGATAACAGCACTCCAGAGATATTAAGATGTGATTTATCAACTTTCATTCTCTAGTTAAAAACACTTGGAGTAGGAGATGTCACTAACTTTGAATTACTTTAGTAGCCTAACGAAAATGCGTATGCAAAAGCATTAGAATAACTATTTGCTTTAAAGGTTATAGATAAATATTGCAATCTTACTTAAGAAATTGGACATAAAATATGTGATTTTAATCTTGAAACTAAGTTAGGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,261.7 L-21,105.8 L-3697.3 S-0455.9 S-3312.9
S-6277.3 S-9285.4 S-12334.6 S-15433.3 S-24565.7
C-0586.4 C-2479.9 C-4434.7 C-61,141.7 C-8827.8
C-10939.0 C-12534.9 C-14494.6 C-16475.0 C-18398.0