Summary
Transcript IDgene_000008359
Gene IDTTHERM_00395730
Length1682 bp
Sequence
GTTCTAATTAATTGATTGATTGATAATCATCACTAGTTTTACTTTATTAAAGTCAGATTTAAAATTGAGAAATGTAGTAGCTTGAATAAGTTAAATCTAATTTAGATATGAACTGCCTAGAAGAATAATCATTTGATTTCGAATAGTGTTATGGACAATATATTATGCTTTAAACACCATCTCATTCTTTGCTTAGCTCAGAAAACTAAAATTCTGAAGATTAGTAACAAGAAGAAAATAGAAATCAAGAATTATTATCTAAAAAGATAGTAAAAAAAAGAGCTAAAAAAGTATCAAAATTCATCCAGCAAAAGCTGAAATAGAAATTGCAAATAAATGAAAAGCTGGATATTTCTCTCTTCAAAAATATTTAACTTCATAAGGATATATTTTATATTTTCGGTGATTAAATTATTGAACTAGATTATAATTTGAAACCTTTTGAAGATAGACCAATAGACTTAAATTAGATTACGCAATTTAAAAGTGTCAAAATGGTGGAAAAAATTAAATAAATTGATACTATCGAGCTAAATTATGAAATGAGCTCAACATAAAGAAGCTAATTTCAATTTGTCATAGACAGGTTTTTATAAAGTGATCAAAGAGATTTATATTAATTCGGTTTATGTTTACAGAAACTCTAAAATTTATCAGTTTGCTGCTAAAACGATCTTAATAAGCATCATTAAATATTAACAAATCCACAAAACTGCTTTGCAATGATAGAAAAATAAAATCTATTTTACTAAAAAAGCTATGAATGGATTAAGTCAAAAACTGATGAGAGTGATTTTTTTACATACACACTTTCTAAGCTAAACTAAGAGAATATGATATTCTAGACTAATAAGACAGGTATTAGCAATTCATTTATTGCATTGTTAGGAGGTGATTTTGATACCATATCTCAAGTTGCTCTTCGAAAAGGGGGATTACATTTCTTGAATTCCAGATCAAGGTTTTTATAGGTTTTTGACTAAATATAATACATAAATACGTTTTAAAACCCACAAAGAGAGCTAGAGTTTGAGCTCATAACATTCGACTAAATAATTGTACCTTGTAAAGCAACAGTAGAATATCTCTATCTTCCAATTTGTAGAGATGAAAATTGCTTTTACAGAAAAACATACAAAATCGATTCAATATATTGGATGAATTTTTATTCTACTTGTAAGTTAATAAAATATCACGTGAGTCCAAATATTATAATGTAGGTAATTGAGACCAGAAAAAAATTGAGTCAAGAGCAAAAGATATTATATGAATCTTACTTTGATGATTTTGTATACACCACTGAAAGCGAAATATTTTTAGAAAAATACTATCAAAAAGAAAAAGATCGTCTGAATAAAGAGAAAAATAGCAAATTACAGCATTGTGGTTTCATAACAATAAAAAATTGATGCCTTTTTCTTTTATATTAATAAGTTAAGACATTAATCAAAATGAACTTAATTAAGAAAGACACTTGTTAAAAACTAAAAAGAAATGAAATGAATGGATTCTTATCTGATGTATATTCTTTGAATTAGCATATTCAAATAATCATATGCGCTTGAATGTTAATAAAGATGCACACACTTAAATATTTTAAATTTTCTATTCTAAAAAATATTATGTTAACTTCAATAATAAATAAAATAAATTAAAAAAAGAAAACCTTATTTATTGCTATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1145.4 L-2124.2 L-3144.9 S-0226.5 S-3232.6
S-6254.6 S-9193.4 S-12177.8 S-15185.4 S-24182.6
C-0358.1 C-2553.8 C-4731.4 C-6682.9 C-8366.1
C-10250.6 C-12125.2 C-14285.3 C-16250.6 C-18305.4