Summary
Transcript IDgene_000008421
Gene IDTTHERM_00784600
Length3797 bp
Sequence
CAAAAATAGATAAAGATAAATTCAATGAAGAGAGTTCAATCTTAAGAGTAGCTTGGTTAAGCAGAAAAAAGAGGAGGAGTTTAAGTGTTTGTTAGGGTAAAACCCACATAAGATGGTGACCAAAGCATATTTTCAGGAGATGATGAAAATGGTAGATCAGTTGTTGCCACTAAAACCCCTCAAAGATCAAGATAAATATAATATAGCTACAAAAATGATAGAAGTTTAGAAAAGTTAAATGAAATATTTTAAGATAAGGCTGATGTTTTCTTTTTTGATAATGTGTTTAGCCAAAAATCCAGCTAAGAAATCTTCTATCGCAAGACAGCTAAAGAAGCAGTTTCAAACGTTGTTAGTGGATAAAACACTTCCATTTTGATACATGGTCCATCAAGATGCGGAAAAACATATACTCTCACTGGTGCAGATAAACACTAAAAAGGATTGATGTTTAGATGTGTAGATGATCTTTTATCCAAAATAGATGTTGCCAATGAATAGGATTCCTAATACAAATTATTCTTGTCTATTTTCTCAGTATACAATAATGAGATATTTGATCTTCTCAGTAATGAGAATTCTGATTATTATGAAGTAATTGAGTATAGTCCAAATGATGTTAGAATTGCAGGTATGTCAAGACATTTAATCAAATACAAGAGCGAATTTAAGAATAAATACGTGAATGCATTAAAGAAAATATAGTCTCTTAGCTAGCTTTTGAATGAAAAAAAGCTTTATGAAAAAAGTCATATTGTTGTCCAGTTCAATGTTTCTGAAAGTGAATAAATAAATTTCAAACTCAATTTAGTAAGACTTGCAGATATTGATTTAGTAGATAAATAAATAAATGGAGATGATTTTGAGGTTATCGAGCAATACATTAATTAAATCAATTAAAACACTTCATATTAAACTAGAGCTTATAAAAAGTGTAAATTAACTTCATGCATTAGAGATACAATTAATGAAAATACTCAATCTTTCTTTATATCATGCGTTTCTTCATCATCTAATTAGTATGCTTAATCTCTTCTCTCATTAGACTATACATAAAGACTTTGTGCTTAGGGCTCACGCCTTCATGATGGAAATGAAATTAGAAGTAGTTTTACTAGCAATTCTTAAAAAAGACTCCTTCCTAGCAGACCTCCTGTTTCACCAAATTCTGTAAAATCAAGCTTGATTGAAAACACTTTGAGACCTCAGCTCTCTTAATCAAATTTAAGATAAAGCAATATTATTAATCAAAGTAGCACAGCTCCTAAATCAAATATTTAGAATTCTCACATTGAGTTTATTGTTAATGAGTTGGAAAATATTTTTGAGGATATTCGTAAGCAATCACGTGTATTTGGAAGACTACCTGAAAGAGAAAGAAACGAATGGGTTAGCTAAAAAGAAATCATTTTAAACGATCTTTAGAGATAGATTGAGTTACAGCCCTACAGCAGAGATATTCCTTATTGCGAGACTCTTCTAACCAAGTGCTAAAGATAGTTAAGACTTATTAATCCTAGCTTAAGCGATTAAAGATAAATTAGTGGTTCTCCTCCTTAAGGACATGTGAATAATTTAGGGCAAGGAAAGCTAAATGGCTCATAAACAAATTTCTTTTAAGGAAATTTAAATAATAGCTTTTCTAGAGTTAACCAACACAATAGAAGATAAAGTTAAGGAGGATATGCTGAAAAAGTAGGTCGCCTTTCTCCTTCTCAAGAAAACAGATATAATGATTATGAGTTTTTAAAAGATAAAGAAGAAAAATTAGACAAAGACTTCATGCGCCTTCTTGATAGATATAATCACTCTAAGGAGCTGATTGATAGTCTCAGCAATCCTTAAGGATAATAATAGCACTCTCAATTAAATCAACCCTATCCATAGTAATTGTAAAGAGTTTAGACTCAACCTTCTCTAGGATAACGCTCTCCTATTTAAAGTATTATCAGAAACAGCTAAATCCTCTAATCGCCTCAATAGAGATTAGCTGATATAAGCAATGTTCATCAATAACTCTAAAATAATCAAGAAATGTATCGTACTCAAGATTCATCAGGATTTTTAGACCAACCTCCTATCAATAAATCCAAGGTTGCAGTTTCTAGCAATATTGGAGAACTCAGTCCTAATTTTGACTTACTTAATGCAGAAGAAAAAGAGAAAAATGTAGGAAAAAGCTTAAAAAGACTAAAAGAAACAATTGAAATCAAAGAAAATATAGAAAAATCAAAAATATAAAAACTCTAACTACTTAATAAAGACTTAAAACAAAGTTTAAGGGAATATGTCGAAAAATACGAGTAGCTTTCTGATATTCTAAACAGCAAAGATGGTGAAATCGATAGATTGTAGTATGAGCTTAGGTAAGCTTAAGAGGACATTCTTCTTAATGTTGATACAGTTAAAGAATTCAAAATAAAGGAATAAGGATGGCTACAGATGGAAGAGGAGCTCAGAGAATCAAATATACAATTAAAATCGAAGCTACTCAAGAAGAAGAAGAAAGTCAATTAAATAAAGGAGGAATTTAGAAGAAAAGAAGAAGAGCTTGCATTTTAGAAAAAATCACATGACCACGAAATAGAAAAGTACTAAAGAACTGTTTAAGAGCATGAAGAAATCAAGTCAGTAGACCAAAACAAGGCAACTGCTCTTTCAGAAATAGTTAATTAATTAAAAAATGACATGGATTAGAGAGAATAAGAATAAAAACAAGTCTTCTAAAACTTACAGGAAATGAGATAGTTGAACTAAGAGCTCAACTAAAAATATCAAAATGAAGTTATTGAGAAGAATGAAACAGTAAATTAGAATCATGCTTTAACAAGAAAGAAAGAGGAGCTTGAAGAACAAGTGCAAATTCTTGAATAAAAAATTTAAAAGCACAAATAAAAATTTGAAGATGAAAAATCCAAGCTAATGGAGGAGAGAAACTAAGAAAACTTGAAGAAAAAAGAAAAGATAAAGTTTTTAAAAGCTTAATTAGCTGATAACGAGGACAAACACCAAGAAATTGAAGGTAAATACTAGCTTCTAATAAAGCAAGCTGACAACTTGGAAGCCTAGTTAAGAGAAACTTAAAAGTACCTTAATGAATTAAAAGAAATAAAAGACGAATAAACTTATAAGATAGCCAAATTGACTGAAGAGAAAAATAACTCTTATTTGGAGAATGAAAGATTATAAAATTTAGTTACCTCTTTAGAGGGTAGGGTAGAAAAATTGGAGGCATCACAGTTGGGAGATGCTAAAACTATCAACGAGCTAAAAGAACAAAGCAGCCGTTTGCAATCTGAGCTTAATGAAAAAGAAGATCAATTATAAAAGGCTAACTAACACATTGATTAGTTACAAGAATAGTAAAACATCGAACTTAGCACTTTTGAAATAAGATTAGACCAAGTTGTTCAGGAATTCACAGCCTGCAAGGAAGAAAACAATGAATTTAAGAGAAAGGAAATTGACAACAAGAAACTCCTTCAAAACTTAGAAGAATAAGTTGAAAAGTATAAAGAAAAATACTTAAAGGCTAAACACTCAAATAAAAATCTACAATCTCATTTAAAAGAACTAGAAAATCGTGTAAAAGATTACATGACTGAAAGATCTATAGAAGTTTAAGCCTAAGCTCGTGAACGTGAAAGACAAACTAAAGTTGAATAAACTCAAAAGAATAAATTAAGAATTCTTGATGAAATTTAACAAATGATTAAAAGTCATAAACACAATTCCACAGTATAAAAATATGAAAATTGATTCATTAATATATGCTGATAAATAAACTTACAAACAGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,053.6 L-22,838.2 L-33,060.9 S-01,882.4 S-31,414.1
S-61,182.3 S-9721.8 S-12930.7 S-151,015.8 S-241,241.7
C-01,144.4 C-2597.8 C-4699.7 C-61,037.1 C-8736.7
C-10782.3 C-121,268.7 C-14928.8 C-16946.9 C-18954.7