Summary
Transcript IDgene_000008427
Gene IDTTHERM_00784520TTHERM_00784500TTHERM_00784490TTHERM_00784480
Length2936 bp
Sequence
TAAATAAATTAATATACAAAAAAAGGCATAGCGTATAGAGAATTATCAAAATTGAGGATACATAACCCAGAAAATAATAAGAAACTTTTAATTCTTAGATCTGAATACTATGAGCGAAGCTCTGATATAATACGATATAATCATATTAGGAAACACAAAAACAGGGAAAAAAACATTGAGGGACTTTCTTGCTAGTTTATCTCCCTAAGAAAGCTTGCAATAAGGAGGAAGTAGTAGAATAAGCATGATGAAAAGAAAGTATTAACTGAATTAAGATGTTACTTTCTCAGTGAGATATTGGGTCAATAGGGGTGATTTCAGAACCTATTCAAATTTTATTAAAACTATTGAAAACGTGAAGGGAGTTGTAGTCTTAGTTGATTTAAGTGACCGTAAATCTATACAAAAAATTGAAAACTACTTTATTAGCTTCCAAAGAAGAAATCTTCCACTTTTCTTAGTCGGAAACAAGTGTGATCTTGACAGTATTAAAAGATGATATAAATTTTATGAAATTATTAAAAGCATTTTTTTTGAAAAATGTTTTAAATAATTATTGCTTACTAAGAAGGATAATAATTATTACTTACTGAGAGGAAAATGATAATTATTACTTGTTAAAAGGACAGTAATTATTACTTATTAAGAAGGCTAGTGGCTGCTTCAACTCAGCTGCTACTTATTAAGAAGGATAATAATTATTACTTATTAAAAAAGGATAGTTATTACTTGTAAGGAAGGATAATAATTATTACTTATTAGGAGAATAGTTATTTAAGTTTGACCTAAAATTTTTTAAGTCAAATATTAATAATTATCATTGTTATTTCTCCTTTAAACTAATAACAAAACAAACAAACAAGCAAACACACACAAATGCAAGCACTTACTTACTTCTAACTTGCATCCTTACTTAACTAATATCTCACTTTCTTCCAAGGAGATAGTTATGTTTACAAACATATTTTTTTTATTATTTCTTTACATCTTTCGGACTCGTCGCCTTGCTTCTGCCCACCTAGAAATTTTCAATTTCATCCTTTTGAACGGCATAGAGAAATCTTGTCATTCAAAACTAGGGAAAGGAGTAAGGTAAGACAGAGATCCTTTTTCACAAAAGATAACAAAGAAGACAATAAAAAAATTTACTGTAAACGGCAAAGAGTATAAATAGTAATTAGGTAACGACAGCAATCAATCAATCAATCAATACTCATGCAGTACTGAGAATCAAAGGTAATTGCAGGAGAGAACCTCAGATGTGGATATTGCTGAGCGTCATTTAGCCAAATGAAACAAAACAAGAAAATAAAATTCATATAAACAAACACACACAACTACATACATTCTGCTATCATCCTTGAAGACATAAGAGAATGAATTGGCTATATTTGGCTATTTGCGATCTTGGGTCCACTCCCCCTACGGTTCTCTCCCTCTCAGCCTCCCAGGGTTCGGTTTTGGGACACGTTAAAGTCGCGAAGAAATGAGAATCTCAGCCTAGCTAATCCGAGATGAGGAAAGGTGTTAGAAAGCTAGTTTTGCGGTTCGTACAAAACAGCACTCTCTAACCATCTATTTCCTTAGGTTTGATTAATGCTACTGATTTTATAGTTTCTTCGTACCGAATCATTCCTGAGCAGTACCCAAGTACTCTTAGGAGGGGGGATGATAGTGATCAACCCATCCATTATTTATTATATTTAATCAACACTCAACCAATATATAAAGAACTTTATATATATTAATGACTATCAGATTTTTATCAAAATCAACAAGTTTTTCTATCAATCCATCCATCCATCATCATACATACATATTTGAAAGACAATCAAAAGTAATCTTCATAAAATTGGGGCATAAACAAATAAGCATACTAACAAACTAAAACAAATACTTACTTAAATAAAAAACATAAAAGCAAAATAAGATCAACAAAAAAATTAATCATTAAACGGTATCATTTTGTTTATTCAAAATTGTTTTAATATATAGAGAAGTATCATCAAAAGAGATGATGAATATAGCTTAGCGTTTCAACGCTCAATATTATGAAGTTTCTTTGCTAACAGGTGAAATGACCGATGAGTTATATTAGGGAATTTTACTTAGCACTTTTAAGGAAAATTATACAAAAGGCAGCTGCGGCACTTATGTTAAGAATGTAAGAGAATTGTAGCATTAGAAAAAGAGAGCTCTCGCCTACAGATATGCTTTAGAGTAAGTTTATGGAAACACTATCCGAAAAGATATTCTCAGATAGTCTCTTAGCAATATTGTTCCCTAGTAAATACTTTAAGGAGAGACAGATTAAGATGGGTATAGTCGAGAGGCCTAGTAAATCTAGTAGTAAATTTAAGGCAGCCTTTTCGCTGGCAACTTCGATGACTAATAAGATCAAGGACTCTTCTAAAACTTTCTCGCTAAGAACTCTCTCATGACTGACTTATCTTCATCTGTTATCCAACACATTGCATTCAATCCTTAGTAGATTGATGTTTTAAACTGATGAACCAATTATTTTTGCCAAAATAAAAATTATATATAAATAATCATACGAAAAAAAATTAGAAATCCTTGAAATATATTAGAAATCATTAAAGTTGCTTAAAAAAAGCACTACCTTAATTAAATTCATAAATTCTCTCTCAAGATAAAGTATCCTATGATATTCAATATTAAATAGATATAGCTTATTGATAATACTACTTAACCTCTACTAAAAAATTACTATTGTAATGATCAAATAAATAAATAAATAAATCATCTTTGGAGTGTTCTCTTATACTAAGATTATAAAAATAATAAAAAATTGTTTAATTTATTTATATCTATTTCATATTAATATCATTCGTATTTTATTTTGTTTAGAATTTACATTTTATGTATTATATGTGTATTCATTCAATCACTTATAATTATACCATATATTAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,186.4 L-26,816.0 L-36,646.3 S-010,857.7 S-311,927.2
S-611,426.2 S-912,756.6 S-1211,591.4 S-1511,047.2 S-2412,000.6
C-013,687.6 C-223,996.5 C-429,192.7 C-623,503.0 C-813,144.3
C-109,674.3 C-1211,636.0 C-1413,484.0 C-1614,046.9 C-1812,350.5