Summary
Transcript IDgene_000008467
Gene IDTTHERM_00623030
Length1315 bp
Sequence
CAAAAATAGTGCTTTTAATTTCTTTTTAAAAGATAAAAGTGATAATGTAATAACATTTGGATCTTTTGAATAAGGAATTAGGTCTTTGTTTGATCATAGATTTACTTAAAGCGACATACATTAGCTATGGTTCAAAGTATCTGATAAAAAGGATCATATTATAGACCGTAATAGGTTTTATAATTATTTATTTGATCCAGAATTCCCAGAAAAAAGTTAAGGTAATACATAAGATGGTTAAGGTGCATTCCGTCGTCCTCTAACTGCTCCTGCAGGAGGAGGTACTAATAAGTTAAAAAAAAAGAATGGAGAAAAACAAGCAGAAGAAAAAGCATAATCAGAAATAGATGAAGAGGCAAGGTTAGTTGTTGAAAAGGTAAAATAGTTAATGAGAGCAAGCAATAAATCAATTGAAGAGTTGTGTGCAAAAGTTGATATAGAAGATACTGGAATACTATCTATTATTGAATTCAAAAATATCTTCAGAAATATGAACTTAAACTTAACAGCAAAAGAAATTGATAAAATTGTCAGCTATTGTGATGAATCAAATAATGGAAAAATAGATTGGAAGAACTTCATAGAAAAATTTAAAATCAAGGAAAGTGTTTCAAGAATCATTGATAGATCTAAGTAAAGATTATAGAGGATGAATGAAGATATTCATTACTATATGATTTCTCCAATCGATGCTTTTAGAATATTTAATGAAGAAAGAAATGGAAAGTTAACATTTAATTAATTCACAGAGCTAGTCAAGAAATTATGCTAGATGTCTAAATAGGAACTCCCTTCATTTGCAATTATAAAGGATTTATTTTAAATAATTGACACAAGAAAAGATGGAATAATAGATTAGTAAGAATGGGTACAAACATTTGCTAAATTTAAAGCTCCTGACTCTTCTCTTTAAGGAAAACCTCTTATTTTATCATAATCCAATACATAGTATGAAGAACCTAAGCTCCTCAAGCCTCTTTATTTATCTTAACAAAAGGCTATCAATTCTGATACTCTTGATTCAGAAATTAAAGAATATGATTAATTGATAACTATAATAGGGAAAAACAGAAAATTCTTATTAGATTAATTCAAAGCTATTAACCAAAGAGAACCTGTCACTTACGAAAAAGCTTTGTAAGTAATTCATAAAATGTTTGTCAGCTTAGGTAAAAATTTAGACCATTCTTGCTACTAGAAACTTTTAAAATTTGCTGAAAGAGACGGAGTTATAGACTATAAATTCTTATTAGATGTATATAAAGAGAGAGTTTCAAAAATAAACGTGTAGCCTGTTGCGAAAATCTGAAAAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1897.7 L-2873.3 L-31,119.1 S-0381.4 S-3514.6
S-6403.7 S-9304.2 S-12356.2 S-15328.5 S-24266.6
C-0518.6 C-2123.4 C-4200.1 C-662.6 C-8286.7
C-10439.2 C-12577.7 C-14746.5 C-16890.9 C-18838.3