Summary
Transcript IDgene_000008471
Gene IDTTHERM_00623060
Length2893 bp
Sequence
ATAGTTTTATTATTATTTTTAATTTAATTTAATATAATAGTTTGTTGAATTGCATCCCAATATGAACTTAAAAATTTTTGAATTTTCAATCAATTATCTAATATATTTAACAATTTTTCCAAATTAGATAATCAATCATTCACTTATGTTTCATTTCGATTTATCTTCAACTTTTAATTATAGGTGGAAGTTTAGCTTCAGATGATTTATACTTGCTAGATTTACGTGGCTCTGATGATACTGGTTTATGGACAATAGTTCCAGTAGTTGGTCAAACGCCTGGAAGACGTTATGGCCACACTATTACATATACTAAACCATACCTAGTAGTATTTGGTGGTAACACTGGTTAAGAGCCTGTTAACGATTGTTGGTACTTGAATGTTGAGAAAAGCCCTTTTAATTGGTCTAAAATTGATGGCAGTAAGCAAGAAAATCCCAGAGTTCGTGTCTATCATAGTGCATCTCTCTGTTAATAAGGAAGTGCTAATGGTATGGTTGTTATTTTTGGTGGTCGTTCAAATGATCAATCAGCTTTAAGCGATACATGGGGCTTACGTCGCCACCGTGATGGCAGATGGGATTGGGTACGCGCTCCTTCTAAAGGTGATAAAGATTAACCTACAGGTCGTTATCAACACTCTTCAGCTTTCTTAGGAAAACTTCTTTTGATTATTGGTGGTCGTACTAATAATGTTGGAGAGCATTTAGGTATGGAAGTCTATGATACCGAAACTTCTGAATGGTTACGTTTTAACTCAATCTAACGTTTCCGCCACGGTTCTTGGATTGTTGATAATTCTGTATACGTTTATGGAGGTTTCGAACTTGAGTCTCCTAATATTCCCACTGACTAAATAACTCGTATCAACCTACTTAAAATTTTCTAATCGAACAGTGATCTCACTAACAAGGTGATATAGTACACAAACAACAGTAATAATAGCACTCTCCCTTCATAGCCTCATTCTCCTATTTCTCCTAGTTTGAATGACTCTAGCACAAATGCTAATTCAAATAATAGCTCTATTAGGTCTGGATTTAGTACTCCGAACACTTCCCCTTCTATCTAAGGTCCTGTTTCTCCAGTTCTCATGGCATAATAATAAATGCCTGGTGGATCATACACTATGGGAGGCATATAGAATCCTAATAAACCTAATAACCTTGCTCCTATGAAGCAAACTACTCTTGGAGGCGGATAGATTTAGAGCAAACCACTAACATTCCTTCCTGCATTACAGGCTGATGAAACCAACAAAATGTCAGATATGAAGAAAAAAGGAAAAGTCAATAATATGATCAACTACTCAAATAATGGAATTTACAAGAACCCTACTGATACAAGTGCTATCCATCACTAATTCATATAGCATTTATTATAGCCTAAGATGTTCATTAACCTTCCAGAAAATGTTATTTTTAGATTCACTTCTTAACAAATTATTGAATTATGTGATAAAGCTGAAGATATAATTCGTTAATAACCAATGGTTCTTAGAGTTAGAGCACCTTTGAAAATTTTCGGTGATATCCACGGTTAATATAGTGATTTAATGAGATTCTTTGATTTATGGGGATCTCCTTGTGAAAATGGTTAGGATGGTGATATAGAAAGTTTTGATTACCTTTTCTTAGGTGATTTCGTAGATAGAGGTTCTCATTCCCTTGAAACTATTTGTCTTCTTTTGGCTCTTAAAGTAAAGTACCCCAACTAAATACATCTTATCCGTGGTAACCATGAAGACAAATGGATCAATAATGGATTTGGATTTAGTGATGAGTGTAATCATAGATTGGGTGAAGATCCAAGCGATGATGATTCAGTTTTTAATAGAGTAAATAGACTTTTTGAATGGCTACCTCTTGCAACAATTATTGAAGACAAAATTATTTGCTTGCATGGTGGTATTGGTAGCTCATTACACTATATTCATGAAATTGAAAATCTTCAACGTCCTCTTGAAGTTATTCATGAAGTTAACACCCCTGATTAATAATTAGTTGTAGATATTTTATGGTCAGATCCTACTGAATCTGATTAAGAGCTTGGTATTCATCCTAATAGTATCAGAGATCCTGTTGGTTCTGGTAATATCGTGAAATTTGGCCCTGATAGAGTAAACTAGTTCTTGTAAACAAACAATTTGAGTATGATTATCCGTGCTCATGAATGTGTAATGGATGGATTTGAACGTTTTGCAGGTGGTAAGTTGATCACTGTATTTAGTGCCACTGACTATTGTGGTAGACATAAAAATGCAGGTGCCGTTCTCATTTTAAGAAATAATTTTGAAATTATTCCCAAACTTATTTATCCTTCTGAAGCAGCTCAACAACATTACTGGATTGAAGATGATGAAGCTTTAAAGAAAAGACCACCTACTCCTCCTAGATGGGTTAACAATAATAATAACATCAGAAAATCTTATGACTGAGAAAACCACTTATGTATTGAATCTTCATTCAAATCCTTCAATTTTTCTTTAAACTTAACTTTTGATCCTTCAAAATATCTTTCATTAATAAATACTTTTAATTATCACAAAACAATTTAATATAAATCATTTATTGAAAATATCAGTTCTTTTCTGGTAAATATAATCCTCCTTTTTTATAAAGTAAATAAAATTACTAATTAAAATAAACAAAACAAGTAAATTATGTTGAATAGAAAGATCATATAAATATACCTTCATACATACATAAATAAATAATTACATGCTTAAATACCAACACAATTAACGATTTGAATATTCGAACTCAAAATATTACATGCAAGGCAGTTATGAAAAACTAAATTAATAAATATATTATTATAAACTTTTAATTAAATTAAGTTAACTATATTTTATCTGTTGTTTTGTTTTTTATTTTTAAGAAAGTAATTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-115,332.0 L-213,841.1 L-315,261.2 S-012,966.9 S-324,450.2
S-623,714.2 S-935,256.4 S-1238,370.8 S-1541,892.6 S-2449,949.2
C-022,425.7 C-211,903.7 C-422,671.1 C-642,860.1 C-832,412.3
C-1024,884.6 C-1223,130.4 C-1420,520.8 C-1624,407.8 C-1828,691.8