Summary
Transcript IDgene_000008568
Gene IDTTHERM_00695780TTHERM_00695770
Length3443 bp
Sequence
GTTTTCACACAATCAATAAAAGAAGTATTATTTTACCAAAACTAAAAAAATATTTTTGACTTTACTTAAAATCAAAATTAATTGAAGTTATATTTTAGTTTAACAAGGATGAGTATTTTTCTCAACTTACTTAACTTGCTTGTATTAGCTTGTTTCTATTTTCAATAAGTGAAATGCGTGGATATTTTAGAACCAGCAGATTTAATGTATGATGAGCTATTAAAGGAGAATAATTATACAAAAGATTACAGGATATTAAAGAAAAAACAAAGCGAAGAGACAATTATGGTTTCTCTTGATAGTTTGGGTCTAAATTATTAGATTCAAGCAAAGTATATTTATGATAATGAAGAAGTTAATGCAAAATAAGAATATGTATTTTCTTCTTACAGTAGCCATCTATTTTTGACAGAATACATGCAAAGATCACCTTCAACAAACAAAACATTAATATAATTGTACTAGCAAAGCAAATTAATTGGCTATGAAATCAGGTTGAGCTTGCAAGATACCTCTAAAAATAATTAAACTGAGTTTGAATTCAAAATTACATATTATAGAGAAGAAGACATTGATTCTCTAGAAGATGGTACTTCGACTAAATTTTTGAATATGTTCAGTGGAGACAGTGAATGGAAAAAAATAGACTTTCCTGTAAATTTAATGGAAATGATGATATTTACGCTAGAAAATGCATATGATATTGAATTTTTTATGTATTCAAAATTTGCCAACAATTTGACATCAACAACTCCACAAAACTGTGCTATCCCTTACACAATTTCCAGATATTCTCTAAAAAGCCTGTAATCAAGTCAAACAGTGATGATACTTTTGAGACGCAAATATGATATAAATCCTAAAACAACTCCTAATATAATAGACTTTAAACTGAGTATATTGTCTATTTATTCTCTTGATAATAAGCTTTCAATATTTCGCCATGATTTTGCTAATTTTGACGTTTTGCTCCCAATCTTCAATGCAAATAAAATTTTAAATAAGAAAAGCAAGAATGAGACACAAAAAAGTTTTTTGGAAATCTCAAATAGTTAGCTCAATACTTCAAATTAAAATAAAACCTTTGATTTCTAAAACTCAACAATTTATTAGTAAAAAAAAAATTAAACAAAATTGTTAAATTCAGAAAAAAAAAATTAATTAAAATATGCAAATTTGAACTAAACTAGAGGTATCAATCAAATAGAAAATTAAAAATAAATTTCAAGTAAGAAAAGGTAACTATAGTTGACTCCTTTTGAGTAATTTATTATTCAAAATGTAATGGAATATGAGGTTATATTTCCAATTTATGATTATACTTAGCCCTTTTATTTAGGTGCAGTTGCATCATCCTGTAACTCGTATATTAAATATTAATTATGCAATATGATTGATGACTGCTCAAGCACTAATCTTCAATTAAATGAAACAGATTTAGTCTACTTCAGTGATAAATTTTCTAATATAGATTAAACTACTACAGCAAAAGCTTTAATAAAACCAAGTGAGTATAATTCTTGCAAGCCAAACTGTTTTGTTCATGCTATTCTTCATATAGAGCTGTTACTTGATCCTTAGTCTGATTTTGAAACTTTTAAATTACAAAGCTCTTAAATAATTCATGATATGAGTAATCCTGCAAAACCATTTTTTGATTATCTACCTCTGCTTGCATATACTTTTTTTTCAGTTGAAGTTCCAGAAGATTTAAATCAACTAACAATTTAATATTTTTCAGGGTATTAACACTGCTATCTTTTGTTTTCTCACTCATATGTACCTATAAAGGATAATAATACTTCAGTAGTATCAGAAAGTATAGATGATAACACATTACCAAGCTAGATATAGTAATTGAGAAGAACCCTTTAATATAGTGGAGATAAATTTTAAACTGAATTAGTTAAGTATGAACTCCCTGAAATAGATTTAAGGCCTGTAAAGCACTCCTTTTATTTAGACACAAAGTATCCAACATTTTAATCAGGTTAATTAATTGTTAAACCAGCCAAAAAAGGAATTCACATTTTTTCAACAATTAATTTATCTCCTATGTATTCTCCATTCACCATTTAAGTAAACTCTTTTAACTTGAGGCAAATGACTAATTCCTCTTACATATCGATAACTCTTTAAGGAATAAATGACCTTTAATCTTTATACTACGACAAAACTAGCACTAAAGATAACAATATTTTATTATAATTTTGCAGTTAATTAACAGATATTACTATATATGCCAGTTCTTGTCCAAATAATTAAACTATATCTTAATGCCATATCCCATCTAAATAACACCATTCTTTTTATTAGAATATCGCATCAAAGAATTCTTCTATTCCTGACTTATGTCCTAATGAAATATGCCATATTTTATTCACAATCTAATATAATCCATTTACAGTCTTAGAAGATTAAGAAGAATCAAATGAAAATTAAATTAAAAAATTTTCAGTTACTTTGATTGAAATAGGTGATAAATCTTCATAAACAGTTAATAAAGACGACTAATCTAAAAATTAGCCAAAGAAAAATGAGGCAGGAAATACTCAAGAAACTCCTTATAATTACAAGTGGATTATAATTTCATGCTGCATTCTTTTAGGATTAATTACTTTAGCAAGTGGTTTAATGTGCTACATCAAAATGAAACAAAACAAGATTTTAAAGTAAATGAAGCGTTAAAACAAATAACTCCTATCTAAAAAAAATGGTTAAAATGATGAATATAATGAAGATGAAGATGACGATGAAGATGATGATGAAGAGGATGATAATTTTGAAGTTGGAGAAGAATTCAAAATAAAAGATATTGAATCTAATAAAAAAATAAATCCTATTACAGTAAATGAAGATATGTTTTTAGAAAGGACAAGTACAAATTCTAGATAGAATGGCGAATAATATCTTTCGATAGGGTGATCAATATGATAAATTCACATAGCAATTTTTCAAAAATTATAAACAAATAGCAATATAAAAACATAAAATAAATATCAAAACTATATAAAACATAATATAATCATAACCATAACAATATTTAAAATCATTTATCATTAATTGAAGCTTCAAATATTAGTAATAATTATACTAACATTGAGAAATTTTTATTTATAAAATGCTCTCAAAGTTTCCAAAAAACAAAAAATCACCTAACAAATAATGAGTCTTATAATAAAATTATTTTTGAACGAACATTTATTTAAACATTAATAATATATAAAATTAAAATATGCATTTCTGTTTGCTGTAACTCTTTTCTTCAAACAAAACCAAATAATCACAGAAATTTCTATTAGATTTTATCTTTGTTTAATTTAACACTAAAATAAGATATATGTTTTGAAACTTTAGGTATTATTCGAGAGGATTATTTCAAGTTAAACTTTTCATTACTTTTTAGAGTTTTATATACATTTAGTAAGGAGGTCAGTTTCATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1394.1 L-2454.9 L-3431.0 S-0579.2 S-3625.1
S-6436.5 S-9632.0 S-12622.1 S-15541.3 S-24640.1
C-0966.7 C-22,403.0 C-43,981.9 C-63,448.3 C-81,022.9
C-10704.2 C-12604.8 C-14823.0 C-16869.0 C-18921.5