Summary
Transcript IDgene_000008710
Gene IDTTHERM_00462850
Length951 bp
Sequence
ATTTTTTTTCTACTCAAATTTATTAATATATTTCGCAACTCTAAAAAAAAGAGCAGGATAATATCAATTAATTACTCATAAAAATATTTTCATTTCACGATAGAATAAGATAGAATGGCAGATAAATTTTAGCCCTTTTAAGAAGAAACTGATCATGGAGATTAAAATTTAGATTTTAACATCTCTATGGATGATAATTCTTAATAAGCAAAAAAATCCATTGATAGCGATGCAAAAATCCAATAATAGCAATAGCTTCAAAAATAAAAGCAAACTATTACAATCCCTGCTGAATCTCTTCCTGATTATTCAAAAACTGTAAGAGTAGGTGAAACATCTTATCTTAGTTAAGCATCTCATCCTAAAATGTGCATATTATAATTATTATTCAAAGCATCTTCGATTACAACCTTACTATTAACTTCCTTTGTTTTTGATTTCTTTGATACTAATAAAACATTCCCATTTGTTATTATTGTTCTCTCAGCTGCCTTTGACTTCTGGGTTGTCAAAAATCTTACTGGCAGATTCCTCGTTAAGTTGAGATGGTGGAGTGAAATTAATGAAGATGGTACTGAATAATGGAGATTCGAAAGTTACGAAGATGGAGTACCTCCTAATGCAATTGATTCTGGTTTCTTTTGGTTTTCATAAACTGGTGCTTTAGTTTTCTGGATTCTATGCTGCATTATTAATCTGTTAGCCATCAGTCCATTTTATTTCACACTTAGCATGATAAATACAATATTAGTAGGAGGTAATTTCACAGGTTACTATAAATGCAAAGGAGCTCACCAAAAGAAAATGAAAAATGCTGTTTCTAAATTAGGTTTAAAGATTATTAGTGATGCTTTTTGAAAGTGATTAGTTTAAAATTTTATATTTATGAATTTGTGTTATTTATAATTGATGTATTCTTATAATATATTTGTTCAAAAAGTTATATTCAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,040.5 L-26,565.2 L-37,062.2 S-012,271.3 S-39,200.6
S-69,969.7 S-99,888.0 S-129,796.8 S-1510,791.4 S-2410,304.4
C-07,202.7 C-26,120.5 C-46,575.8 C-64,552.0 C-83,373.0
C-105,702.5 C-126,250.7 C-145,525.1 C-165,507.1 C-185,683.4