Summary
Transcript IDgene_000008723
Gene IDTTHERM_00463160
Length1386 bp
Sequence
CTTTTAGGTTAAGAGTGATTCAAAAATAAAATTTTATGAGTCCTTTGTAAAAAATAGAATGCATTAATACTAAAGATAGCTTGTCTAAGTATTTATATGAAAGAATGTTCAATTTAATTGTGTAAAAGCTTAACGAAATAATAGTGCCAAAAGAAAGCATAGACGAGTCTAAAATAAGTAAAATAGGGCTTCTAGACATATACGGCTTTGAAGTATTCAAAGAAAATGGTTTTGAATAGTTTTTTATTAACTACACTAACGAAAAATTGCAACAACTCTATATTTAATATGTATTTAAGTAAGAAGAGCAAGTCTTTGTAAAAGAAGGACTTGAAAGCTACCTCCAATATTTAAGTTTTACAGATAATAAACCTGTTATTGATTTATTAGACATGCCACCTAGCGGTATATTTAATATATTAGATGATATTTGCTAGACAAAAGGTAATGATGAAAAGTTTTTGAACAAAATCCGCTAAACACATAAAAACAACAAATATTTTCAGATTCCCAGAATCACTGCAAAGCCAACTTTTACTATTGTTCATTCTGCTAAGGAAGTAGAATATACTGCCACAGTTTTTACTGAGAAAAATTAAGATGAAATTTAAGAGCTGATAATGAATGCTTTATTATAGTCTAAAAATGAACTACTCTCCTCATTAGCTTAGCAGGAAATTGAATCAAACAAGAACAAAAAAAAGGAAAAATCTTTGGGAAGTAAATTTAGAACGGAAATGTAATATTTAATGAATGACTTAATGGCTTGTGACTGTCATTTCATAAGATGCATAAAGCCCAATGAAGAAAAGAAAGCAAATTGTTTTAGACCCGTTAATGCCCTTTAGCAAGTAAGATATTTAGGTGTCTTAGAATCTATTAAAGTTAGAAAGTAATCATATCCAATAAGAAAAAATTACTAGCTTTTCTACAAAAGATACTCACTTATAAACTAAGATTTTAAGCCTTATCAGCAACTGTGTTAAGAAGACGCTGACTTTATTTCTCTAAGCAAAGGCTTGTTCAAGACAGTGTTCAAAGGTATAGATGGCAATGGAAATATATTATTTGGAAAATCAAGAATTTTCATGTAAAACAGAGCTCTAAATGACATAGAATAAGTGTATGAAAACAAATTAGAACAGCTAAACAAAACTGCAAAGAGATTCTAAAAAGCTTATTACTCTTATAAATAATTAAAAAAGCTAAGGAGATGGTTCTAGCTTATTAGGATATGCTAACAGCTGATAAAGGTGAAGATCTTATACAAGAAATTTAAGGATTAAAGAAAAAAAGCATAGAAGATATAAAATTGGTATCGAAGACATTTGCAGAGAGAGCTCATTAGAAAATATAGACAGTCTGCTTTAGTCATATAAAACTATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1249.3 L-2303.5 L-3238.1 S-0177.4 S-3135.5
S-6120.9 S-9116.9 S-12104.2 S-15106.6 S-24253.9
C-0223.5 C-2664.6 C-4219.0 C-6192.7 C-8216.9
C-10436.1 C-12431.7 C-14335.5 C-16224.2 C-18266.4