Summary
Transcript IDgene_000008724
Gene IDTTHERM_00463160
Length1347 bp
Sequence
CTTGAATATTTTAGCATTGTCAAGAAAAATGTTCTTGTGATACAAAAATGTATTAGAAAATTTTTGGAAAAAGCTAGGTTAAGAAATATTTAGCATTGCAAGGATAAAATAGAGAATGAAGTGTTAAACTTTGCATGGAATTTTATTAGAAAAAGGTCTTGCATTTAGATTTAAAAAATTATTCGCGGTTTTTTGGCAAGGCAGAAGCTCAGGGAAATGATTTTAAGAGTAAAGATGGTTGGAAGAATGATAAGGGAAAGAAAGGCTGCTACTAAAATTCAAACTAATTACAGAATGCATACTAATAGAAAGAAATTTTTAGAAAAAAAGAAAGCTGCTATGAAGATTTAGGCTTTTATAAAGATGAAAATCTTGTCTGCGTTTTACAAATAATTAAAATTCTCCACAAATAAAATACAAAAAGCTATGAGGAAATTTTTGATTAAAAAGCATATCAGATTAGAAAGATTGTAGTCTTATGTTAATTAATGTGACTTTAAAAATTTACTTTCTACTGAATAGTCTAACTCACTTGGATAAGCTGAAGAAAATAATTTATACTCTAATGTTTAAGAGATGTATTACATATAAAAAAAGATCTAATATAAAAGAAAAAATGCTGGTAAAAAAATGACTTTGAATAACAAAAAGGTATCTGAAACGATTATTCCTGGAATTTAAATACAAAAGAAAACATCTATCAAACCACTTTTTAGCTCTCAAAAGAGTTAAGAATAAATTTCAAAAATGGTAAACAAATAAGTATGTGAGAATTCTTAATAAAAACCAACATCAGAAGGGAATAAAAATAAGATTAAGCTTAAATAAATATCATAATAGTAATTTAATAATTAGACTGATGAAAATAAACTACAAAATTCTCATGAAAGAGATCATTCTTAAGATATCGTCAATAGCAACAGCTGTATTGATTTACAAGATATTTTAGATAGGCATCAAGCATAAAAAACAAATATAATAAGCCCATTAAAAATAGAAGACCAAAAAGCTATCACGAACTAATCAAATGTTGCTAAAAGGTAAAAGCTGAGATAAAAAGAAAATGAATCAGATTAAAATAAATAATTTAGAAAGAGCATATTAAACTCAATGGAGAATCCCTCCAATAATAAATTAGATAATTCTAACTAAAATACCTAAGAATAAAAAATTCAAGACATGTACTATTATACTTCTGATCTTGCTAAAATGCATAACCAAACATCCCCTTAAAAAATAAACTGCACCTAATAAGTCCTTCCTAAAAATCTTACAAATATTCAATCGCCGCTAAATAAAACTTCAAGAGCTAATGAAAGCAATTAAAATATCAAAAAAACATAACTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1436.7 L-2311.4 L-3347.8 S-0249.6 S-3201.6
S-6194.4 S-9197.4 S-12281.3 S-15181.1 S-24254.1
C-0271.5 C-2678.8 C-4260.6 C-6335.2 C-8283.4
C-10662.4 C-12568.9 C-14476.9 C-16372.6 C-18436.6