Summary
Transcript IDgene_000008725
Gene IDTTHERM_00463160
Length1526 bp
Sequence
TAGAAAGTTTACATGATTTCTCATCTGATAGATTTTGAAATTTTATCTGATACGAAAGATATTTATCCACCTAATGGCTGGTCAGAGTACTTCTAATAGCAATTCCAACAAAGCTATTTGAAAAAAGATTACTTGTAAGCCATTTACATTGGAGAAACACACACTGTTGCAGTTAGCAATAACAATTAACTTTACACATGGGGATGGAATGATTTTGGGTAGCTTGGAACTCCAGAGGAGATATCAGAAAATGAACTTAAAATTAATAACATATCAATGATAGATCAGATTTAAATTGAGTAGGCAAGTGTTGGTAATGATTTTACTTTAATTTTATCAAAAGAAGGAAAGCTATTTGGATGGGGAAAAAATAATAAAGGATAGCTTGGATTTTATGATGATGAAGGACTAATAAAAAATGTGGATATTCCTATGGAAATAATCTCAGTTAAAGAAGATAAAATAAAAGGCATCAAATGTAGAATGAATTCAGCCTACATTATCTTAAATAATGGCTCTGTTTATACAAATTAAAAGTATAGTCCTTACTAGAAAATTAACTTCTCTTAGAAAGTAGAAAGAGTTTCATGTGGATTTAATTTTACAGTATTTTTAACCACTAGCCATTAAATATACTCTTATGGAAAAAATTAGCATGGGTAGCTAGGTTTGGGTGACTTCGTACAAAGAAAAGAACCAACTTTGATTCCCTTCTTCAAAACAAACTAAATTAACTAGGTGGAGTGTGGATTTGCTCATGTTGTTTGCTAGACAAACTATGGAAGAGTATACGTGTGGGGATGGGGATAATGCGGTTAACTAGGTCTTGGAGATTATCAAGATTAGCAAGAACCTTAGTTGTGTAACTTAAATAATCTTTATAAAGATATAGTTATTTAAGTTTGTGCTACTAGAACAAGTACCTTGCTTTTACTTAATAACTCAGATATCCTTTGGTTTGGCACTAATCAAAGCATTAAATACTAAGAAAATCCAACGATTTACAAAGTATCGGAAAAGCTAAAACAACTAGAAGGAACTTTTTGCATGAGATTAACAAGCTCATGGAGTAAAACACTTGGTGTTGTCTATGGTACTTTTGCTTTTAGCAAAGATTTAAGTGATAGTGTTCTTTAGTCCACATGCAATACCCTAACAAAAAAATGGGTTAAATAGAATATTGATTAAATTAAACCACCTACAATTTAGAGCATTATTCACAAATTACCTCAATAATATATTGATTTGAAAGAAAGCCCAAAAAAAGCTAAGAATATTTCTGACCTTGTACAAAAAACTTAATCTCCTTAAATAGTAAAAGTAGAGGATTTTTCTAATATCAGCAATATATAAGAAGCTAGCTTTGTTTAATTCGATGTTGAAAAGAGTTTGAATGAATTTTAACAAAGAGAGGATGAAGAGAGAAAAAAACTTAAAGAACTTAAAAATAAAATAGAGTTCTTGAAGACCCTTCCATAAAAATAATTAAGGTAAATAGATAAACAACTCATTTAGCTCTACGAACA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1423.2 L-2521.3 L-3536.1 S-0561.7 S-3471.3
S-6353.2 S-9523.9 S-12623.9 S-15437.2 S-24548.4
C-0698.3 C-21,685.4 C-4573.5 C-6475.5 C-8931.5
C-101,550.8 C-121,387.8 C-14913.7 C-16899.5 C-18708.0