Summary
Transcript IDgene_000008757
Gene IDTTHERM_00463850
Length1347 bp
Sequence
AAAAAATTGAAGATTTTAAGAGAAATCAAAAAAAAAGAATAACTAACTAATTAGCTTTTATAAATAATAATGGCCACTAAAAGAATTATTAACCAAACTTAAGAGCATTATGAAATTTAAAATTTCTAAAATGTCGATGAAATGGAAAAGCATTTGCAAAAGCCTACTGATAGAGTTTTATGTTCTTACTAGCATGGAGTCTACGATGTTACAGACTTTTTACCTGACCATCCAGGTGGTAAAGATCTTATAGAGAAATACAAAGGCAAAGACATTACAGTTATATTCAAGGATGAAAATAGTCATCCTCACTCATAAAACGCAAAGAGAATTTTAGCCCAATACAAAACTGGACAAGTTGCTGGAGACAATAAAGAAAGTATGAGGGAAGGTGAAGAAAGACCTTACCCTTTAAGAGTAGGAAAAATCCTTTACTTTGATGATTTCTAAATCGATCTAGCCAAAGGTTATTTCTATCAAATTTGGAAACTTTCCTACAAATAATACTTAGAAGTTATTGATAATCCCGTCACTATTCCTTTCTATGTTCCTTTGTTTGATAGCAAATTCCTCGATATGTTCTCCAGAAATAAATGGTACACAATCCTCGCTATTTGGGTTCCTATTGCCATTTACCACTTTTACTTAGGTCTTACTTTTGATTATGATGTCAATTCTATTGTTGATGATTACATTAAACTTTCAAGTGCTTCTTTCTCTTTGTTTGCTGTCTTCGCTATTTTGGCATTTGCTGTCTTCACTTGGTCTTTGGCTGAATACTCTCTTCATAGATTCTTGTTCCACATGGAAAAATGGATGCCTGACTAAGCCTTATACAGATATCTTGCATTTATTATCCACGGTGTTCATCATGCTCTTCCTATGGATGGAGAAAGATTAGTATTCCCTCCTTCTTTAGGTGCTATGATGTACTATGTCCTGACCACTGTTATTTATACCTTCTTACCTGGTAATGCTGGAAGAATTTTTGTCACTGGTTTTATTGCTGGTTATCTTTATTATGATATGATGCATTATTATTTACATCACTGCAATCCTAGTATCGAATACTTTAAAAATTTAAAATCAAATCACAACAAGCATCACTATGTCAGTGATGCCAAAGGTTTTGGTATTACTAATAAAATTTGGGATTATCTCTTCGACACTAAATTCAATTGATAATATAACAAATCTTTAAATTTATATAAAATAAATAGGTTTTTCCCTAAATTTTAAAAAGGCATAAAATCTAAATTAGTTCAATATACATAATTAGTTAGTTAGTTAGTTACATATTTTCATCAATTATTCATTGTTTAATTACAAAAAATTATTCATTTATCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-117,643.0 L-218,543.7 L-316,282.5 S-017,900.3 S-318,019.7
S-622,930.0 S-921,576.9 S-1218,421.3 S-1518,426.1 S-2418,454.2
C-013,189.1 C-221,709.2 C-436,048.6 C-619,994.1 C-814,933.8
C-1011,229.4 C-1212,221.8 C-1419,011.3 C-1617,688.8 C-1814,109.2