Summary
Transcript IDgene_000008789
Gene IDTTHERM_00044970
Length1001 bp
Sequence
AAAAAATTCAGTAAATTAAGAAACAGAAATATTTAATTTTAGAAAGAAATGTTTGTTGGATCAAACGTTGATTAATTAAAAGTTAGGCCTGGACTCACTAACATAAATATGGAAGTTAACCAGCCTTTATCTGTTACTAAGACTTAAATTATAAGATCAAACGAAAATTAATAGTTAAATAATGCAGAAATATTGGCTTAGCAAGAAATGTAGAAATCCATGCTTAGAGAATCCAAGAAGTAAGAGAAGTTAGATAAATTTTAAAAAACAATAGTTGAAAGAGCCGCAATTATCGAGAAAGAAAATAAACTTAAAAAGCAAGAAGATGATAGATTGAAGGAAGAGAAAAAATAATTTTTGTTATCTAGAAATAAAAAATCTTTTGGTTAAGAAGAAGGCTCTATATTTTCAGTTCCTGAACAAAGAGAGCAAACTTTTGCTAAGAAAAAGGAAGCATAAACCACAAAACCCAAAGCTGAAGAAGATAAGAAAAAAAAAGAGCCAAATATGAAGCTTTCAGTAGTTTTTAAGGCAAATGAAGAAGTATAGCCTTCTGATCCTAGAAACAAAAGCTAATCTCCTAAATCAGCTAAGAAATCAGAAGTTAAAACTTCTAGTGGATATAATCCTTAAAAGAAAAATAAAAAATAAAATACTCATGCTTAAATGATAATTCCAGTAGTGAGAGAAGACTAAGAAAGCGAAAGTGAAGATGAAATAGATTACGATATATGCAATTTTACTGATGCTGAGGAGGCTGTCACTAAATACTAAAACATTAGACAACATTTATATTCATTGACTTGCAATAAAAAATATTGATTAAATTGATTTTCTTAAAGGTTTAAAACGTTTTTGATAAAAAAAAGTAAGTAATTTATTAATTAATTAACAGATAATATTTCTACAAAAGCACTGCTAATTAAATTAAAAGTAATAAATATTAGACATATAAATACAAATAAATAATTAAATATAAATTTTCATTATAAATAATGTCC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1580.5 L-2560.9 L-3566.9 S-0417.9 S-3586.3
S-6566.7 S-9585.5 S-12714.1 S-15638.9 S-24802.9
C-0481.4 C-2517.0 C-42,126.6 C-61,565.5 C-8822.7
C-10906.3 C-121,297.6 C-141,222.3 C-16962.1 C-18756.5