Summary
Transcript IDgene_000008790
Gene IDTTHERM_00044980
Length893 bp
Sequence
TTTTATGCAGTAATTAATATCTAATCTTAGATAATAAAAAGTATAAAAGTAAATAATATCTTAATAAAGTTTTAAGTAGAAATGACAGAATAAGTAGAAGAAAAAAATTTAAGACCTGCTCGCATATATAATTTTATTAAGCAAGATTACATAGATATGAGAGAATTGCCTAATGTTAAGGTTTCTTCAGGATCTTATAGTATTTCTACAGAAGATAAAAAATTAGCAATTAAGTCTATAATTATGAGAAAAAAGAGGCAAAGAGGCTACGACAGAATTCTTTTCTAGACATAAAATACAGTAAGATCAAAGGAAGAAGAAGCAGAGTTAAAGAAAGACAGACATAGTTTTATTAATTACCTTAAAAGAAAATACAAGACATAGATTCCTGAAGAGTTACTAGATAAATCAAAATAAATTTAAAAGTAGCATTCAAGAGGATGGACAATCTCTGATATAATTTAATATGTTGAATAAAAAAATTCTAAAAAAGCCATAAAAAAAGAATTAAAGAAGGAAGAAAAGACTAAGGACAAAAAGAAAAAAGAAAAGCAAGAATAAGAAGAATAGGAAAAAGATAATTTCAATGAAGATGAGTCTTTTGAGGAGTTAGCTAACATTGATGATGATAATATAAATGATGAAAGTGGTGGTGGAGACTATGATGACTGAATAAATTAAAATAAATCATTTCAAAGCTAATAAATTTTAACTTAGATAGAAGTTCAACTAAATTTCTATTTATCTATCTATCTACCTTCCTAACCATCAGGGATTTAAATTACTAACTTAAACAAATATAAGAAAATCCAAGGTTGGACAATAATTAATTTCATAAATTGATCATGTATATATATAGCTATGATTTTAATCTTTAATATAAATAATTTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,370.9 L-2879.9 L-3668.5 S-0196.6 S-3315.2
S-6447.8 S-9226.0 S-12190.6 S-15145.0 S-24199.9
C-0184.2 C-298.2 C-43,001.4 C-62,505.6 C-8712.0
C-10367.6 C-12117.4 C-14439.0 C-16430.2 C-18235.5