Summary
Transcript IDgene_000008803
Gene IDTTHERM_00046120
Length591 bp
Sequence
GAATAATAAGATCATAATTATTAATATAAAAGCTGATAAAATAGTTTGCAAATTGTAAAGTAAATTAAAGATATTAAAAAGTTTAGTTTTTCTATTAAAAATGAGTGACAACGAAGAAAAAAAGGAAGTTAAGCCCATAAAAGGTGACGATGGCAGTTTATACTTTGAGCTTGATGACAAAAAAAGAGTTACTGTAAGAAAATTTAAAGGTAAATTATATGTTGACATCAGAGAGTTTTATGAAAAAGATGGTGAAATGCTTCCTGGAAAAAAAGGTATTTCCTTAAATTTATAAAATTGGGAACAATTCAGAAGCTTAATTGACAGTATTGATTAATGCATAACTGATATTTGAGCAAATCATAAGCGATTATACTAAAAATATAAGCTAAAATAGTAAAAATGTAACATGGGATCCTATTCTAGAATAAATAAAAAAACAAATTTAGTTTAAATTAGTTTTGAATATATATTTATAAACTCATTGTAGAAGTTTTACTACTTTCAGTATCTCAAAAGCAAAAAATTTATATTATTTTTTTACATTTTGTATTAAATTTTAATAAATCAATCTAAATTTAGAATAGCAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,859.8 L-21,736.3 L-31,420.0 S-01,210.0 S-31,250.2
S-61,240.5 S-91,058.1 S-12887.2 S-15824.2 S-24722.8
C-0600.1 C-22,079.4 C-42,033.3 C-66,270.8 C-84,935.2
C-104,990.5 C-122,370.7 C-141,948.9 C-161,705.6 C-181,380.9