Summary
Transcript IDgene_000008809
Gene IDTTHERM_00046170
Length615 bp
Sequence
AATAAATCAAGAAAAAGGAAAATTAAAATAAACTCATTAAAGGCATGGGTAGTGTTTGGTTTAGAAATAGATATTGGTGGTACAGATCACTTTATGATGATTACGTTGCTAGAGAAGCTAAGTTAGCTTTCGGTATAGCTGCATTCATCTGGCTTCCTCACTATTACTGGGGTATCCATCTTAACAGAGCTTTCGAAGTTAATTTCTCACACAGAAACTATGCTCACGAATGGGGTCCAAGAAGAAATAGACTTGCTCACTCACTTGAATTCGAATAATTCGATATGATCCTTGAAAATTGGCAAGATTTAGAGGATGAGTATGCGCAGAGAGGGGATGGAATGCTGAAAAAGTGAGTAAAAAATGATTCGCACATGATAAAATATAATGGCAATAATGCAAGTGGTTTTTTGTTATGATATCTGCTTAATCTGAATTTTTTAAAGGGCTATGATATATTGATAGAAACATAAAAATTTGATTTATTTTTAGTATCTCATACATTTTAACTACACATTATTGCAATATGATTTGTATTATTAAAATAGTATATATTCATTCCTAACTTAATGATACGAATCTTGACTAAATTATATTTACACATACATACTCATC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-137,435.6 L-235,209.5 L-333,589.3 S-024,925.3 S-319,053.5
S-614,990.7 S-912,690.0 S-1211,147.1 S-1510,300.7 S-246,535.7
C-06,463.4 C-25,791.9 C-45,220.0 C-63,567.1 C-85,349.6
C-1011,300.1 C-1211,706.6 C-149,736.4 C-169,477.9 C-188,329.3