Summary
Transcript IDgene_000008882
Gene IDTTHERM_00046990
Length915 bp
Sequence
AAAAATATTATTTAAAGCTTTTACAGGGTTTAAAAAAAGAATTAATTATAATTTTAAATTCATTTTATAAAATGTCAAGTTTAAACTAGAGTATTGTCAATTAAGATATTCATAATACATCAAATGATGCTGATTTGAAAAAGAACAGAAGTATGCGCTTAATGCAGAGATTAGAAAAAAAATATTCTGAGCAAGGAGACCAAAAAACCTTACTTGAAAATAATGAGAACCTAGAAACAAGTTCTATTTAGACAAATCAATCTCAAGAACCTGCTATAAAAATCACTTCAAATGAATTCAAATAGAATAAGCCATAATAAACAGAGAATCAAGGTATATCAGGCAGCGAAAAGTTGGAATTGATGAAAAAGAAAGATCAAATAATAGAGAAATATGATAGACTTAGCATTATCATTTGTGCAGTTCTTGGGGTTATTTTGGCAATACTTTCAAAGTAGAGTATGTCAGTGAATTTTTTATTGATATTTGTTAGTTATCAATTATTGTATTAGATTATTCAAAGGAATTTTCTCTTGGCACGTATAAACTCATTATTAAATTAAGGCTAAACCGAATTGAATATTGGTAGTTTTGTCAGTGAAAAAGCTAATAAAGCCATTAATTTAATTTCTCATGTTTCTAGATTCAGTAAAGTTTTTAGGTAGTTGGCTGATGATATTTCTGCATTCTTGTTTACTTTTGTTGTCTTTTCTTAAATACTATAGCGTTTCTGAGATTAAATGTAAATAAATTTAAATTAATCACATACAAGCTGTTTTAAGATATGACTAATTTAGATCAAGCTATTAAATTAATATTAATTATATATTTTTAAGTTACGTAAACATAAAATTGTAATAGTCATTTATTTGTGTCAAAGTAAGCTGTTTTCGGCAATTTGTATTTTAACAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,275.0 L-21,900.1 L-31,744.8 S-01,098.5 S-3836.1
S-6991.5 S-9958.8 S-12806.6 S-151,060.6 S-24785.1
C-0407.1 C-23,247.4 C-45,763.6 C-610,597.8 C-83,262.5
C-101,421.4 C-122,027.6 C-142,829.0 C-161,793.7 C-18736.5