Summary
Transcript IDgene_000008888
Gene IDTTHERM_00047080
Length2407 bp
Sequence
ATCTAAAAACAAGACTAGGGAGAAAAAGGAAATTTTTAGAAAGAAAAATGTTTAAATACTTATCTAAGATATAAAGAGTTACCTTACACAGCAAAGTTTCAAAGAATTTTGCAGTTTTGTCAAAGGATCATCCCGAAAAGGGACCTTCCCAAGGTCATTTGACTGACAAATACACTGTCATTGATCACACCTATGATGCTATCGTTGTTGGTGCTGGTGGTGCTGGTTTAAGAGCTGCTTTTGGTTTGGTTGAAGAAGGTTTCAAGACCGCTTGTATTACTAAGCTTTTCCCTACTCGTTCTCACACAGTCGCTGCTTAAGGTGGTATTAACGCTGCTTTAGGTAATATGACAGAAGATGACTGGAAATGGCATTTTTATGATACAGTTAAGGGTTCTGATTGGTTAGGTGATTAAGATGCTATCTAATATATGACTAGAGAAGCTCCCGCTGCCGTCTTAGAATTAGAATCTTACGGTCTTCCCTTCTCTCGTACTCCTGAAGGCAAGATCTATCAAAGAGCCTTCGGTGGTCAATCCCTCAAGTTCGGCAAGGGTGGTTAGGCAAGAAGAACTGCTTGTGCAGCTGATAGAACTGGACATGCTATGTTACATACTTTATTCGGAAGATCCTTAGCTTATAATTGCAATTTCTTTATTGAATATTTCGTTATTGACTTAATTATGGATGAAGAAGGTGCCTGCAGAGGTGTCATCTGTATGTCTATGGCTGATGGTTCTATTCACAGAATCAGAGCCCATTACACTGTATTGGCTGCTGGTGGTTACGGTAGATCTTATCTTTCTTGCACTGCTGCTCACACCTGCACTGGTGATGGTATGGCTCTTGCTACTAGAGCTGGACTTCCTCTTGAAGATCCTGAATTCGTTTAATTCCATCCTACTGGTATCTACGGTTCTGGTTGTTTGATGACCGAAGGTTGCAGAGGTGAAGGTGGTATCCTTGTTAACAGTAATGGTGAAGCTTTCATGGAAAAATATGCTCCCACTGCTAAGGATCTTGCTTCCAGAGATGTCGTCTCTAGAGCTATGACTATTGAAATCCTTGAAGGTAGAGGTGTTGGCCCTAAGAAGGATCACATTTTCTTATAATTACATCACTTGAGTCCTGAAACTTTACATTAGAGATTACCTGGTATTTCTGAAACTGCCAGAATTTTCGCAGGTGTTGATGTTACCAAAGAACCAGCTCCTGTCGTTCCTACCGTTCACTACAATATGGGTGGTGTTCCCACTAACTGGAAGACTGAAGTTATTACCCAAGACAAGAATGGAAAGGACAAGATTGTTCCTGGTTTGCTTGCTGCTGGTGAAAACGCTTGTGCTTCTGTCCACGGTGCTAACAGACTTGGTGCTAACTCTCTTTTAGATATTGTCGTTTTCGGTAGAGCTGCTGCCAAACTTGTTAAGGAAAAGCTTAAACCTGGTACTCCTCATAAGGATTTACCCAAGAATGCTGGTGAATAAGCTTTAGCCAGATTAGATAAATACAGATTTGCTAATGGTGAATACACTACTCACCACGTTAGAACTGCTATGTAAGAAACCATGTAACGTCACGCAGCTGTCTTCAGAATTGAAAAGCTTATGGCTGAAGGTGTTCAAAAATTAGATCACATTTATGAATAATCAAAGAGCCTTAAAACCTTCGACAGAGGTCTTGTTTGGAACACTGATCTCATTGAAACCTTAGAATTAGAAAACCTTCTTTTATGCTCTAAATAAACTCTTCTCGCTGGTTTACTCAGAAAGGAATCCAGAGGTGCTCACGCCAGAGACGATTTTAAGGAAAGAGATGATAAGAATTGGATGAAGCACAGTCTCACTTGGATTAAAGATGTAAATACTGGTAAAACTGAAGTAACCTATAGAGATGTCATCAACCACACTCTTGATAGTGAAGTTACTCCTGTTCCTCCCGCTAAAAGATCATATTGAGGAAATTTAGATAATAATCAAAAATAAATTAACTTCACTCATTAAAATAAAATTAATGATAAATAATTAACTAAAGAAGTAAACAATATAACTATTCTTAATTTGATTTCAATGAGGGATAGTTAAGTTAATCTTATAGATTCATACATAATGAGCGACTAATTATCTCTACTCACACACTTAATCTTTCTTCGCTAGCATTGTTTATAGATAAAGTACTATTCTCATCAATAACTAACCTACTTACTAGCTAACTAACTCTGTTAGAAATTAAAATTCACTGCTCATTGATTGTATACTGTAGTAATTAAAATTATAAAATTGAAAGAAAAATTATTTATGTTTTTTTATATATCTGATTCTATTAGCAATATAGTCTAGACTGTTTATGTGTTTTGAGTATAGATTTACCTTTAGCAAAAAAATATCTCTTAGTATTACAAAATATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-142,518.3 L-241,347.9 L-348,539.8 S-042,203.7 S-330,465.8
S-616,141.4 S-921,120.5 S-1218,638.6 S-1519,815.6 S-2410,790.6
C-09,614.5 C-210,947.9 C-46,649.6 C-64,513.1 C-814,081.7
C-1031,613.7 C-1230,851.7 C-1419,182.2 C-1620,113.1 C-1813,341.2