Summary
Transcript IDgene_000008899
Gene IDTTHERM_00047230
Length1118 bp
Sequence
AAAGAAGTTAAAAATCCAAAAAAATTAATAAAATAATAAATAATTAATAAGGTTAAGAAAAGGAAGAAAATGTTTAGAGGTTTAACTAAATTCAACAAAGTTTTTGCTTTAAATTCCTTTAAAAATAGCTTAGTCGCCGTTCCAAAGGCTAACTTGAACCATGTTCAAAATATGTTAGAAGAAAATTTAAAGTATGATGCTTAAAAGTATAATGATGAAGTTGCTGTCATTCAAAAGACCTCCAGAATTTACAAGCCCACTTATACTATTGAGTTCAATCGTGAAGGTGAAGTTTTAGTTTACTCTGCTGATCCTATTAAGAACTCCGTAGTTTACTTCAAGTATCCTTATGTCTTATACGAAGCTGCTATTCCCCTCTTCATTTGGGCTTGGATCTACAATCCTTTGGAACTTAGCAAGAATGCAGTCAATAGTTTGCTCATCTACCCCAACATCGCTTGGATTCCCAGAATGTGGTACTGGAGATCTCTTCAATATAAGATCTAAAAAATGTACCTCCTTAGAGGTGGCAAGGTTGCTAAGATTGAAACCCAATCTTTGGCTGGTGATAGATTCACTTCTTGGGTTGAAACTTACTAATTCCATCCCTTGACTTAAGATCAAAAGAACTTCGATAACTAAGATAATGCTGAATTCTTAGAAGATGAAGGTCAATTAAAATACGAATTAGGTGTCCAACTTGATAACTTATAAGAAATGGGTACCACTTCTCAAGATATTGTTATTAACTTCATGAAGGAAGGTACTGTTCACCACCCTGAATTATTTGAAGCTATTGTTAAGGGTTACAATATTGATACTTCTGACTACGTCATTAATACTGCTAATAACCTCAGAGCCAGAGAAGGTAACCACAACCATTGAGCTAGTTATTCAAACTAGAAATTTAAACTACTATCTTGTCAAGATAAACATTAAAATTTATTCCATCTAATACCTATACAGATTAATAACTACATCGTATTAAGTTGTTTGTGATTATTAATATAAATACTTAAACTAATCTTCCATCAAAGGCAGTATAAATGACTTTATATGCATGTTAAATCTCGTATTTCAAGTTTTTGATCATTTTAAATTAAAAATTATATATCTCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-134,911.8 L-235,248.3 L-336,696.0 S-025,856.5 S-319,878.4
S-613,994.5 S-913,014.9 S-1211,284.9 S-1511,658.3 S-248,387.8
C-05,953.6 C-25,620.3 C-46,188.8 C-69,237.6 C-811,580.6
C-1018,913.7 C-1217,048.8 C-1413,164.5 C-1610,386.8 C-189,016.7